Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4062
Length(NT) : 773
Best Gene Model Blast : Link to GSTUMT00010671001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: AMP-binding enzyme (Fum16), putative
Accession: ref|XP_001275297.1| Score: 386 E_value: 1e-35
KEGG Definition: acyl-CoA synthetase [EC:6.2.1.3]; K01897 long-chain fatty-acid-CoA ligase
Accession: aor:AO090011000642 Score: 382 E_value: 2e-35
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1180 Score: 274 E_value: 3e-25
PFAM Definition: No Hit Found
Swissprot: O60135|LCF1_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0004467 = Molecular function: long-chain-fatty-acid-CoA ligase activity
GO:0001676 = Biological process: long-chain fatty acid metabolic process

Sequence:
>Contig4062
TTGGCCCCAACATCCTCAGAACACCTCATCATCCTGTGGGACCCCAGAAA
ATCTCCCATTTCAATTAATACCCGTGCTCCCTTCCCTCCCCCCGCCTTCC
CTCTCGCCATCCTCGCTCCACTCTTCCCTATACCTCCCTTTACTCCACTT
CCTCTCCCGGAGTATTTCCTTACTGCCGTGCTGGGCATTCAACCTTCACA
TATACCTTTTTCTACAGTACTCCCACCTCACCTTGCCTCCCCCGCGTCAC
CGTGCGGTGCTTGAGTTAGCAAAGGAGACACTGTCGTCATGGCTTCCCAG
ACCAAACAAGTCTTGTGGCCGTGCATGAGCAAACGCCCTCCCTTCAATCT
CCAGGTGCCGGGTGTTGAGAAGAAAGAGGGAGAAGGAATTCCCCGACGTC
ATCCAGGCTCAATTAACGGCCTCAGATCGCGGCTGGAGCCGGATATCGCG
ACCACCTATGACATCGTTAAGAGAGGGGCTGCGAAGTTCGGTGACGCCAA
ATGTTTGGGCTCTAGAACACTCGTCAAGCAACATGAGGAGATTAAAATGT
TGAAGAAAGCTGTCGATGGCGTTGACCAGGAGGTTCCAAAAACTTGGATT
TACTATGAAATGTCCGGTTACAAGTTTTTGAGCTTCAAAGAGTACTTGGA
AAGAGTTAACATAATCGGTGCGGGGCTGAAAGCTTTGGGGCTGGGGAAGG
GTGAGAAAGTACAAATTTTTGCTGCTACCAGCGCAAACTGGCTTGGGATG
TCGCATGGGTGCGCTTCTCAGTC

Sequences in the Contig:

SY0AAC23YJ01FM1 SY0AAD15YJ07FM1 SY0AAD58YA12FM1