Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4061
Length(NT) : 813
Best Gene Model Blast : Link to GSTUMT00004069001 E-value : 9e-71
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4061
TTGGGCACGAGGGTCCAACGCCACAGTACTCGCTCCTCTATGATAGCAAA
CCAACTTGAGGCAATACTATTACACACTTATGGAAAGACAGTACAGTACA
TGATTAACAGGATCACTCAATCAGCGTCTATATCATAAAAAACAGGAAAG
CTCAACAATTTTAAATTCCAAGCCGCTACCCTACATCCGCGCCAAATCCA
CAAAAGACGAGAGCAAAGCCAAATACGGATGCCGGTGATAGAAAATGGAG
AAGAGGAGAAAATAAGTGAAAGGTATACCCCCTAGGATATAACAGGACAG
AAAACGCAAATCGCGCGTCGATAAGAGCAAGAAACCCCCCCCCCCTTTTG
TTTTTTGCGAGCGTTCCACCCGTACAGTGTGAGTGATCGTATAAGCCTTA
TTCAAAAAAATGTTGTGGTGGTTATTCATACAAATCGTGAGATGGTGATA
GAGGAATGGGGAAAGGGAAGGAAAGGTTATGGGGAAGAAAGAAAAGAAAG
GAAGGTCAAGAAGAGAAATAATGAGTTGAACTAGGGAACAAGGTTTGAGG
TGGCAATGAAGCGAACCACCGCCAAAGCTCTTCGACAAAAGAAAAAACAA
TTTACTTGCTGGAACTTTTTTGATCTCGTCGTTACGCATGACAGACATAG
AATAAGGGATGTTTTAGTAAGAGAAAGGGAAGAAAAACCCATGTCATTAG
CATTTCGTTTCGTCGTTTTGTGTCCAGACAATCTTTTCAAGGCGCGCCCC
AGTCGGCCCCAGCAATCCTTCCATTCAAGTGGAATTTTCCTATTTTTTCG
AACCCCCTGCCAA

Sequences in the Contig:

SY0AAB51YK20FM1 SY0AAC23YI23FM1 SY0AAD15YJ05FM1