Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4060
Length(NT) : 681
Best Gene Model Blast : Link to GSTUMT00006862001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: alcohol dehydrogenase I
Accession: ref|XP_001228112.1| Score: 544 E_value: 3e-54
KEGG Definition: ALCOHOL DEHYDROGENASE I [MIPS]
Accession: ncr:NCU01754.1 Score: 532 E_value: 4e-53
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG0023 Score: 552 E_value: 2e-57
PFAM Definition: ADH_N, Alcohol dehydrogenase GroES-like domain. This is the catalytic domain of alcohol dehydrogenases. Many of them contain an inserted zinc binding domain. This domain has a GroES-like structure..
Pfam Number: pfam08240 Score: 319 E_value: 2e-30
Swissprot: Q9P6C8|ADH1_NEUCR
Gene Ontology:
GO:0004022 = Molecular function: alcohol dehydrogenase activity

Sequence:
>Contig4060
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCAAACGACCCCTCCCCACAC
TCAATTTATCAATCATGTCTGTCCCCACCGAACAATACGCGCAAGTCTTT
AAGAGCAACAATGATCCAATTGAGAGAAAAAAGGTTCCCGTCTCAAAACC
AGGCCCAGATGAGGTTTTGGTCAACATCAAATATACTGGAGTTTGCCATA
CCGACCTTCACGCATGGAAGGGTGACTGGCCCTTGCAAACTAAACAAAAC
CTGATTGGCGGTCACGAAGGTGCTGGTGTTGTCGTCGCTGTTGGCGAATT
GGTTAAGGACATCAAAGTAGGCGACCATGCGGGCATCAAGTGGATCAACG
GGAGTTGCGGCCATTGCGAATTCTGTATGGCTGGCGACGAGCCCTTATGC
ACAAATGCTCTGCTCTCGGGATACACCGTGGATGGCAGCTTCCAGCAATA
CGCGATTGGCAAAGCCGTAGATGTCGCTAGAATTCCCAAAGGAGTTCCAT
TAGACGCAGTTGCTCCTATCCTCTGCGCCGGAATCACCGTTTGTACCCCG
ACCGATAACTCCCCACTAGCCCTAAAACTAACCCTAGCAGGTTTACAAAG
CCCTTAAAGAGTCCCAAGCCCGTGCAGGTCAAACCATAGCCATCGTCGGT
GCTGGCGGTGGTCTTGGATCGCTTGCTGTAA

Sequences in the Contig:

SY0AAC23YI01FM1 SY0AAC49YI10FM1 SY0AAC56YD07FM1
SY0AAC58YA08FM1 SY0AAC58YG08FM1 SY0AAD28YE07FM1
SY0AAD32YD03FM1 SY0AAD51YL20FM1