Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig406
Length(NT) : 1924
Best Gene Model Blast : Link to GSTUMT00005442001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: glutathione S-conjugate-exporting ATPase Abc4
Accession: ref|NP_594558.1| Score: 1007 E_value: 1e-107
KEGG Definition: hypothetical protein
Accession: spo:SPAC30.04c Score: 1007 E_value: 1e-107
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG0054 Score: 1559 E_value: 1e-173
PFAM Definition: ABC_membrane, ABC transporter transmembrane region. This family represents a unit of six transmembrane helices. Many members of the ABC transporter family (pfam00005) have two such regions..
Pfam Number: pfam00664 Score: 271 E_value: 3e-24
Swissprot: P32386|YBT1_YEAST
Gene Ontology:
GO:0000324 = Cellular component: vacuole, cell cycle-correlated morphology
GO:0015125 = Molecular function: bile acid transmembrane transporter activity
GO:0015721 = Biological process: bile acid and bile salt transport

Sequence:
>Contig406
TTGGGCTCGGGCTTTTGGAGGAGATGCGGCTTTTGAGTGGTGAAAGGTTT
TTGCCTCGTGGTGATGGGGTCGCCTACGTTGCTCAAACAGCTTGGTTGCA
GTCATTAACCATCAAGGATAATATATTGTTCGGTAGTCCATATGAGGAGA
GGAGGTACAATGCTGTTCTCGAGGCATGTGGCCTAACAGAGGACATAGAG
AAATTTGACGCGGGCGACCTTACAGAAGTCGGTGAGCAAGGAGTCACCTT
ATCCGGAGGTCAAAAGGCACGATTGGCATTAGCAAGGGCTGTTTATTCAC
CCGCACAAACCGTTCTCCTTGACGATGTGCTTTCCGCGTTGGACGCTGGC
ACCAGCAGATTGGTCTTTGAAAAATGTATCAAGGGCGAAGTATTGGCTGG
CAGGACCGTAGTTCTAGTCACACACCATGTATCACTTGTTTCACCGGCCG
CCAAGAAAATTATTGTGCTTGCCAATGGTCGGGTGGTTTCGGATAGCAGT
CCAGAAGCACTTTCTGATGATGCAATTGAACTCTTGAGAGAAACTGAAGA
AGCTGATATAGCAGCAAGAGATGTCGTACCAGGCGAGCCAGTCGAACAGC
CGATAGAAACGGTGGCGCCAAAAGCGAAGCCGAAGGGTTCCGGAATGCTC
GTTGCAGAAGAGGCTCGCAACAAGGGAAGAGTGCCAAAAAAGTTGGTGTT
TGAATATCTCAAGTATTTCGGGCCATTGATTATCACAGTTGTCTTGGCTC
TCATCAGTGTGTTGGATGAAGTAGTCGACTTAGTTGATACGTTCTATATC
GGACTTTGGTCTAATGAATACTCCAAACCGGGCCCAGTTGACGTTAAGTG
GTGGCTGTCAATGTATGCAGCTTTGTTGATTGGGACATCAATTTGCAACA
CTTTGGTCTATTCTGTTTGGTATTTCTTCGCCTGGGTAGGGGCAAGGAGA
ATCCATGAGAAATTGGTATCTGCAGTATTGTACTCTCCGATAAGGTTCTT
CGACACTACTCCTGTTGGGAGAATAATCAATCGCCTCTCAAATGACATCG
CCGCGCTCGATAATGGCTTGGGCGCATACGTAAAGATTGTATTCGATCAG
CTGCTCGACATAGTCTTTAGAGCGGGGGTCATGACTGGGTTGTTACCAGC
TTTTTTGTTTCCTACAATATTGGTTTCCCTGATCGGGGTTACATGTGGTG
AACTTTATGTTCGTGCCCAAATAGGTGTCAAGAGAATTATCTCTGTCAAA
GAGTCCCCTTTGATTTCGCACTTTGGTGACACAATATCTGGTATTGTCAC
GATTCGGGCTTTCTCTTGTCAGGAGCGCTTTTGCAAGGAAAATATAAAGA
AGATTGATGATTTCACACAGCCAAATGAGGTCAATTATAATCTGAACCGA
TGGATTGGAATCCGCACTAGTGCTTGTACCTCGATCATTGGTGCTGCTGC
TGGAATCATAGCTCTTACGACAAAGGGCTCTTCCCCCGGCATGATCGGAT
TTAGCATGTCAAATGCTTTGGCTTTTAGCTCCTCTATCCTTCTTGCCGTG
AGGTATTTCAATTTGCTCGAGGTGGAGCTCAATTCCTTTGAACGTGCCAA
GGAGTATATCGAAATGAAGCAGGAGCCTTCATCAAGGCCTGAAGCTGAAC
CTCCCGCTGCATGGCCCACTCAGGGTGACCTCAAGGTTACCGAACTATCA
GTAAAGTATTCTGAGGACGGCCCGGAAGTCTTAAATAAGATTAGCTTCGA
GATCAAGTCGGGTGAAAGGGTGGGTATCGTTGGGAGGACCGGTGCTGGGA
AGAGCAGTTTGGCTCTTAGCCTTTTACGTTTCACCGAAATATCTAATGGT
AGCATCATCATTAATGGACTGGATGTTCAGAAAATCAATCTCGAGGCTCT
GCGACAGCGCATTACAATCATACC

Sequences in the Contig:

SY0AAA22YP23FM1 SY0AAA2YN07FM1 SY0AAA31YA13FM1
SY0AAC52YN07FM1 SY0AAD29YG24FM1