Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4059
Length(NT) : 866
Best Gene Model Blast : Link to GSTUMT00010004001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4059
TTGGGGGGGAGAAGGACGAAAGGTGTGGGGTCAAGAGGGGGGGTGGGGGT
GGATGTGCATTGAGCCGGTAGGAGCCCCGAAGCATGTAAGATGGACCAAG
CAGCCGTCGGACCCGGTACGATTCTAGGGTATATACCCCCCCTCCCCCGT
CACCCTGCACGCCATTCATTCCTCAGTTCCATTCTTTCCTCATGCCACTG
GATGACCATAAATCTCTGGCAATGCGGACCTACATGCTCCTCACCGGAAC
GCAGTCGTAGGTGATACTATTGACCTTAAAGCTCAGCACCTGTTAACCTA
CAATGACTGCCCCATCTGATGGCAGATGACCAATTTGCTCCTCCGTTTAT
ACTGCGGGTACATGTTTCAGGACACTTCAACACTGCGAGTAGGGGACCAA
AAGTGGAAAGCGCCCGCAGTGGATTTAGTAGCCGTCGGACTCGGTGTGAT
TCTGTGGCTTTTCTGGCTTAGAGCTGCGATTGCGGGCTATGCCGCTTGGT
ATTTCTGCCAACGCAGCGTCCCCATCCGAAGACCTAGCCTAGCAGGACAT
GACATTGAGGAAACCACCAAGGATGCCTTGAGTTCTAACGACGAATATGC
CCTCATTAACAAAGACCTAGATGAGGACGATGGTGACAGCAGATTCTCCT
CTCATCACGGACGTAGTGGAAGTGTGGCTAGTTACGATGCTCATCCCGGT
AACCCTATTCCTTGGGGCGGCAAAGGAAGCGCGTATGATGGAATCGGAGG
ACACGGACCAGTGGCATGGATGAGAATAGAAGAACCATGCCCATCGCTCC
GGTTGAGGATTACAATTACAGGGGGGGCGACTGTGAATTAGGATGTTTTC
TGTGTTTTCCTTTTGT

Sequences in the Contig:

SY0AAC23YH18FM1 SY0AAD24YB06FM1 SY0AAD42YC17FM1
SY0AAD62YL17FM1