Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4058
Length(NT) : 642
Best Gene Model Blast : Link to GSTUMT00001758001 E-value : 1e-108
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4058
TTGGTCTGCCGACCGTGCAGATAAAGTTTTAGCTTTTGCGAACTGGGGTG
CGAGAGAGCCCAAGGATGTCTTCCTCAAGAGGACCAGGACCAGGGATGTT
CCATGAATGCGGGGATAAACAACTTGTATCATGCTGGTTACCGTGGGCGA
AACTGCCACACACCGAGCTGTCAACGCGGGGCCCCGAGAGGGAGTTGTGT
GTGATGGTTCCACCTGGCGGACTTGCGATCTGTTGCTGCCCGTGTTGTAC
AGTACTGTACAGTACATTACTGTATCATACCACGGACAATATTTAATTTG
GTGCGCCTTGGGGAGCGATACATGGTTACGGTGTCAGGTATGGGCCTTGA
GGACCGGAAAAGCTCCAGGCCGAACGGTGGCCATGGCAGTGAGCCTGTGA
AGCTCTTCGTCGGGTGGGTGCTGTACAAGTACAGTACAGTACTCGTATGA
TACCAGTATGGTACAGTACTCGAGCACTGTACATATCCTGTGCGGCCGCC
TTCCGCCTCCGGATTTGCAATCCAAAAGTCCTGAAGGGAGGGAAAATAAC
CCTTGCCCAACTACTAACTATAACAATACTAATATATCTATTAATATATC
ATACGAGAGAAGGAAAGAAAAAGAAAAGAATGAGGCCATGTT

Sequences in the Contig:

SY0AAC23YH14FM1 SY0AAC37YE02FM1