Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4057
Length(NT) : 578
Best Gene Model Blast : Link to GSTUMT00010913001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein CIMG_00243
Accession: ref|XP_001246472.1| Score: 298 E_value: 1e-25
KEGG Definition: hypothetical protein
Accession: ang:An08g07520 Score: 293 E_value: 2e-25
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG1205 Score: 172 E_value: 1e-13
PFAM Definition: adh_short, short chain dehydrogenase. This family contains a wide variety of dehydrogenases..
Pfam Number: pfam00106 Score: 129 E_value: 1e-08

Sequence:
>Contig4057
TTGGCGCAGACCAGCCAGGCTTAACCCAACTTAACCAACTCTACTCGTAC
AGCTACAACACCATACCACGTCTATCTAACGAACGAGGATACCCCCTCGA
AAAACTGCCGATCCAGCAGCAAGTAAAAACAGTAGGTAATGTCATCATCG
GCACAGTCTCGATTATTGCAGGTTGCGGGGCATGTTGGCGGCGGTGGCGG
GGAGGGAGGATTACCTCCTGTGCCGATGGTCGCAGGGGATTCGGTTGGGC
CAAGGCTAACCGGCAAAGTCGCCATAGTTACCGGTTGTAATTCCGCCATC
GGCATTGGCCGCGCCACGGCCCTGCAATACGCACGCAACAACCTCAAAGC
CCTCTTCATCTGCGACTTCTCGAATACCAACCTCCCAGCCCTAGAATCCG
AACTGCGCGCCCTCGCGCCAAACACCAAAATCCACGCGCGCACCTTCGAC
GCCGCGGACGAAGCCTCGGTCGCCGCGGTGGTCCAGGAAGCATTAGACAA
GTACGCCCGCCTGGACATATTCTTCGCGAACGCGGGTGTGCTCGGCGGTA
TGAAGCTCGTTGGCGACATCACGGCGGA

Sequences in the Contig:

SY0AAC23YH10FM1 SY0AAC50YI07FM1 SY0AAC62YM24FM1
SY0AAD52YF01FM1 SY0AAD53YN13FM1 SY0AAD59YG03FM1