Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4056
Length(NT) : 874
Best Gene Model Blast : Link to GSTUMT00002983001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001539217.1| Score: 158 E_value: 5e-09
KEGG Definition: hypothetical protein
Accession: ang:An01g13270 Score: 151 E_value: 1e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4056
TTGGCTTCAGCGCAACGTCGAATTGATACTTCGTGATCCCCCCGGAAAGG
CAAGACCTGAGCGAACTGAAATCTTAGTCTGCCAGTTTGGGGAAGGGGAA
GTTTCTGATAAATGGCTTTTGTTCGCACCGATCCCCCTGGGTGCTATATC
TGCTAGGACGGGTGACGCAGCAGGCGAAATTGTCGTAATGGTCAGGGGAA
TGGATCCAAGCAGCCAGGAAGAGCTTCGGGAAATTCTCATTTTAGGTTCT
CCTACCGCTGCGGGATTTGAATGGGTTCAGATCTCGGACTGATTCCAATC
CCTCCGGAGGGGCCTTTTACGGACAAGCCTTATCAAATGCATACGCTAGA
GACACTGACCGAAGAGGGAACACTTTCTTCGCGTTGGCAATCACCAGCCC
CGCCACACTCCTCTCATGGGCCAAAGACACCAAAGGCACTTTCTCAAAAA
TCAGAACAGGAAACACAGAAGAAATCAGAGAAATCAGAAAGCGTTGGCGA
CGTTTTTTCATTCCTTGAGTCTGATAGGGCAACGCCAAAACAAGAACCAG
CACCCTTGGTTGTTGAACCCCCGAAGACAGTCAAGCCACCGTTAGAAAAT
GCTTCCGGGGCAGAGGGCACAAATGGACCTAAACCAGCGGAGCATTGTGA
GGTTCTCCCGCCCGACTTTGCTATGATGCCATGCATCGCAGGTGGATACT
GGTTCCTCGGCGGGCATTTCAAGACTCCCGAAGCGAAGACCGATGCCGAG
CAGGGGCTGGGAGCTCAAGATCTTCTTGCTTCCCCACCTCTTCGTCATTC
GGCGTCCTTGCATACATTGAGCGACAGGTACTCGGCCCCCAGTGAGGGTC
GGAGTCCAAGTCTCCAGCGCTCCC

Sequences in the Contig:

SY0AAC23YG19FM1 SY0AAD45YB12FM1