Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4055
Length(NT) : 766
Best Gene Model Blast : Link to GSTUMT00000611001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: adenylosuccinate lyase Ade13
Accession: ref|XP_755526.2| Score: 940 E_value: 1e-100
KEGG Definition: adenylosuccinate lyase Ade13, putative [EC:4.3.2.2]; K01756 adenylosuccinate lyase
Accession: afm:AFUA_2G11940 Score: 940 E_value: 1e-100
KOG Definition:
Classification: [Nucleotide transport and metabolism].
Kog Number: KOG2700 Score: 746 E_value: 7e-80
PFAM Definition: Lyase_1, Lyase..
Pfam Number: pfam00206 Score: 132 E_value: 1e-08
Swissprot: O60105|PUR8_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig4055
TTGGCCCGAAGAATTGAGGGAAATACATACAAGAAGAGCTCTTCCACCTC
GAACATTCCCCCACCCCATCCCCACCAACTAACCAATCACCAGCACAATG
TCCAACAACGACATCTACCAAACGCCGTTGGCATCCCGCTATGCCTCGGA
GGAGATGGCCCAGCTCTTCTCCAACAAGACACGTTTCCGTACCTGGCGTC
AGCTCTGGGTGTGGCTAGCGAAGGCGGAAAAGCAATTGGGACTACCCATC
TCTGACGAGGCTATTGCCCAGATGGAAGCACACCTCGACCTCACTGACGA
GGATTTCAAAGTCGCTGCGGAGGAGGAGAAGCGGAGACGGCATGACGTTA
TGGCGCATGTACATACGTTTGGACAAGTCGCCCCGGCAGCGGCGGGGATT
ATCCATTGGGGTGCCACTAGTTGTTACTGCACCGACAATGCCGACCTCCT
CTTCCTCCGTCAGGGTCTCGACATAGTCCTCCCCAAGCTCGCCAACGTGA
TCTACAAACTCTCAAATTTCGCTCTAGAGCACAAAGACTTGCCGGCACTG
GGCTACACCCACTACCAACCGGCGCAGCTCACAACCGTCGGGAAGCGGGC
CTGTCTCTGGATCCAAGACCTCCTCTGGGACCTTCGCAACCTAACCCGCG
CGCGCTCCGATCTCGGCTTCCGCGGCGTGAAAGGTACGACTGGGACACAA
GCCTCCTTCCTGGCAATCTTCAACGGAGACCACGACAGAGTCGAAGAATT
GGACAGACTGGTCACT

Sequences in the Contig:

SY0AAA52YB03FM1 SY0AAB32YC08FM1 SY0AAC23YF19FM1
SY0AAC52YN03FM1 SY0AAC54YG05FM1 SY0AAD22YE21FM1