Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4054
Length(NT) : 1079
Best Gene Model Blast : Link to GSTUMT00009672001 E-value : 2e-53
Numbers of ESTs : 25

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4054
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGGTATCTTAGCCCCTACT
TCGGCAAAGCCAGAATCCATCCACACACACGCATCCTCAGACACCACCAT
CCTCCTGGTCCACACTCCCAACACCACCACCTCTACATTACAATAACACC
ACCACCTTCAGCACAACTCCACCTCAGAGAGCGATACGGCCAGTGAAACT
CCTGTGCTACGTACTATTTTGCTTTCAGATTTTCCCTCTTATTCTCTCCT
CTTCCTCTGGACACAAACCCTTCTCAACCTAAACTCTTGACTTCGCTATC
ATATCACTCTTACACTCTATTCTCCATTTCTGCCGTAACCCCTTCGTCTA
GAGCCTCTCTATCCTTCCACTTCACGGAGGAGAAGAAACGACAGCCCCTC
GTTGTCATAGCTCTTTGCTTGCGGCCTTAGCCCTAAGAACTCCTCTCGAC
CCGCTCGTCGTCTTCTATCGTGTCCTTACGATAAACCTTCTCATCAACCT
ACCGCAACAGCCCTATTCTATTTTTTGCCCTCGACCGTCCATCTGGCCAG
ACACCTTACCGACACCCATCTGAATCATATTTCTCCACCCCCCTGTTCCG
TCCTACACCTTTTTCTCAGGGCCTTGACTTTTCTATCACAATCAGTTTCT
TATCAGTCGGATTAGAGGAAAGTTTGAGAAGAGAGGCAGAAAAAAAAAAA
AAAACCGCCCCTAGCAATCAGAAAGAAGGCCGAGTAGATTTTTCTCGATC
TTCGGTTGTTCCCTTCTTTCAACTCCTAGAAATCTTTCGCTGTTGTTTCT
ACCCCCTTGTGTGCTGAAAAGGTTTTTTGTTCTTTTGTTGTGAGCAGTTG
CTGCATCGAAGCGCAAGATCCGGATCGCGCTTAGGGATCAAAGGATATTT
TGCTCTGATTGTATAAAATATTTATTACGTTCCGGTCGACACATCTAACA
CCCTTAGTCTCTGTTCGCCGTCTCTAAATTTCTCTTTCTCCACCTCTCCT
TTTCTCTTCCTCTTCCTTTTCTCTTTTCTTCTCCCCCTTCCCCCTCCACT
CTTTACAACACTATGGCGGACCAAACAGA

Sequences in the Contig:

SY0AAA19YJ14FM1 SY0AAA26YO15FM1 SY0AAA30YK22FM1
SY0AAA41YF24FM1 SY0AAA55YF02FM1 SY0AAA61YM10FM1
SY0AAB19YH10FM1 SY0AAB22YE22FM1 SY0AAB31YH08FM1
SY0AAB44YG17FM1 SY0AAB55YK22FM1 SY0AAB56YP19FM1
SY0AAB61YD05FM1 SY0AAC14YB14FM1 SY0AAC20YI03FM1
SY0AAC23YF05FM1 SY0AAC29YH23FM1 SY0AAC39YC23FM1
SY0AAC3YG22FM1 SY0AAC42YN17FM1 SY0AAC9YI24FM1
SY0AAD39YL22FM1 SY0AAD41YH18FM1 SY0AAD42YN22FM1
SY0AAD44YF08FM1