Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4053
Length(NT) : 668
Best Gene Model Blast : Link to GSTUMT00011684001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_15502
Accession: ref|XP_001805648.1| Score: 439 E_value: 7e-42
KEGG Definition: hypothetical protein [EC:2.4.1.80]; K00720 ceramide glucosyltransferase
Accession: mgr:MGG_10668 Score: 391 E_value: 1e-36
KOG Definition:
Classification: [Lipid transport and metabolism, Cell wall/membrane/envelope biogenesis].
Kog Number: KOG2547 Score: 272 E_value: 5e-25
PFAM Definition: Glycos_transf_2, Glycosyl transferase family 2. Diverse family, transferring sugar from UDP-glucose, UDP-N-acetyl- galactosamine, GDP-mannose or CDP-abequose, to a range of substrates including cellulose, dolichol phosphate and teichoic acids..
Pfam Number: pfam00535 Score: 128 E_value: 2e-08
Swissprot: Q16739|CEGT_HUMAN
Gene Ontology:
GO:0005624 = Cellular component: membrane fraction
GO:0008120 = Molecular function: ceramide glucosyltransferase activity
GO:0008544 = Biological process: epidermis development
GO:0006679 = Biological process: glucosylceramide biosynthetic process
GO:0006688 = Biological process: glycosphingolipid biosynthetic process

Sequence:
>Contig4053
TTGGCGCCCCTCTCGGTCGTTCCATTGCCTCCACCGGGGCACGGCGGAAG
CAGTAATATGTTCCATTTTGCTCCCTCCGCGGTCCAGGTCATCTTGGCCC
GGGTGTTTCTGTCCTGGTTCGTCTTTGTATGGGCTGTCTGCATGGTAGGC
CATGTGCGAATGAAACGAATGTACTCACGACCTCCGCCTTCGGTACCCGT
AACTCACGGCGTCTCTGAAGCACTTCCATATGTCTCAATTCTTCGTCCGG
TCAAGGGTCTTGACCCCTTCCTGCAGTTATGCCTGGAATCTACTACTTTG
CTGCGGTATCCTAAGTCGAAGTATGAGTTGATTCTTTGCGTGGCCTCTCC
TCATGATCCGGCGGTACCGATTATTCGGCAAGTCATTGCTAGTCATCCCG
AGGCAAATGCAAGGATCTTGATAGGCGAAGAAGACGTTGGACCTAACCCA
AAGATACGGAACCTCAGCAAAGGGTACAGGGAGGCCAAAGGCGATATTGT
GTGGATCTTGGATAGCAACATTTGGGTTCCATCGGGAATCCTGGATCGAA
GTGTTCGCCTGCTCGAGGGGCTTGATCAGGATGGCAAGGGCTACAAATTG
GTTCACCACTTGCCTCTCTGTGTCGATGTTTCTAACAACTACCGTCAACC
GCCATCTATACCGTCATC

Sequences in the Contig:

SY0AAC23YE09FM1 SY0AAC27YN11FM1