Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4052
Length(NT) : 2084
Best Gene Model Blast : Link to GSTUMT00005323001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: hypothetical protein CIMG_04062
Accession: ref|XP_001244621.1| Score: 2163 E_value: 0.0
KEGG Definition: hypothetical protein [EC:2.1.1.14]; K00549 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase
Accession: ani:AN4443.2 Score: 2156 E_value: 0.0
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG2263 Score: 2011 E_value: 0.0
PFAM Definition: Meth_synt_1, Cobalamin-independent synthase, N-terminal domain. The N-terminal domain and C-terminal domains of cobalamin-independent synthases together define a catalytic cleft in the enzyme. The N-terminal domain is thought to bind the substrate, in particular, the negatively charged polyglutamate chain. The N-terminal domain is also thought to stabilise a loop from the C-terminal domain..
Pfam Number: pfam08267 Score: 974 E_value: 1e-106
Swissprot: Q9UT19|METE_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0046084 = Biological process: adenine biosynthetic process
GO:0009086 = Biological process: methionine biosynthetic process

Sequence:
>Contig4052
TTGGTTTCCATTGCGGGCTCTTTAAAAATATCCTCCATCACTACTCAATT
CAAAATTTCTATTCTAAAACAACTAGTTCATCCAATACTCATTCACAATG
GTTACCTCGTAAGTTTTCACCAAAGGAGAAATTTTTTCCAGATGATGAAA
TATCCATCTTAGCTCTTGCCTTGATAGCAATTGACTGATATTCAATTGAA
ACTTTTAGTTCCGTTCTCGGGTTCCCTCGTATGGGAGGTTTGTTCATTCT
ATAGTTCCTATTCGTTATTTTTATGGGGCATTGTATCTGATTCCCCTCTA
GGGAATCGTGAGCTTAAGAAGGCGACTGAGGCATACTGGGCTGGCAAGAT
CTCTGCCGAGGAGCTCATTCAAACCGGAAAGAACCTCCGTGCCTCTCACT
GGAAGATCCAGAAGGATGCTGGTGCTGGGACTATTGCCAGCAATGATTTC
TCTTTCTACGATCATGTCTTGGACCATATTCAGCTATTCAATGCTGTCCC
AAATAGATACAGGAAATATAACCTTCCTGCTCTTGACGAGTTCTTTGCCA
TGGGCAGAGGTCTTCAGAGGGCTGCTACTGAATCGAGTCCTGCTGTCGAT
GTTCCCTCTTTGGAAATGGTAAAATGGTTTGACTCGAACTACCACTATGT
CCGCCCTACTCTCCAAGACAACCAGACTTTCTCCCTTGCCGCTGATCCCA
AGCCAGTCCGTGAATTTCTCGAAGCCAAGGCCCAGGGCGTCAATACCCGC
CCAGTCCTTGTTGGTCCGGTCTCCTTCCTCCACCTAGGCAAGCCAGACCG
TGGTGCATCTGTCAACCCAATCACCCTCCTTGAAAACCTCCTCCCTGTCT
ACATTGAACTCTTAACCAAGCTCAGGGAGGTTGGTGCCGAGACTGTTCAG
ATTGACGAACCCATTCTCGTTCTTGACTTGCCCCCTAGGACTAAGGCTGC
TTTCAAGACTGCCTATGCTAGGATTGCCGCCGCTGGAGTTTCGATCCCCA
AGATTACTGTTGCTACCTACTTTGGCGACATTGTCCACAACATTGACGTC
CTCTCCAGCTTGAGTGCCGTCTCTGCCGTTCATGTTGACCTTGTCCGCAA
CCCCGAGCAACTCGACACCGTCACTGCCGCTCTTGCTCCCGGCCAGATCC
TATCTGCTGGCGTTGTCAACGGACGAAACATCTGGAAGACCGACTTTGGG
GAAGCCATTGCCATCGTTCAAAAGGCAGTCAATGCTTTGGGGGCCGATAG
GGTCGTTGTTGCTACTTCGTCTTCTCTTCTACACACTCCTCACACTCTTG
CTAGTGAGAAGAACCTCCCCGCTGAGGTTGCCGACTGGTTCTCGTTCGCC
TCTGAGAAAGCTAGGGAGGTTGCTGTCATTGCCAGAGCTGTTACTGAAGG
GGCCGCATCTGTTAAGGCCGAGCTCGATGCCAACGCTGCTTCCATGCACT
CCCGTTCTACCTCGGCACGCACAAATGACCCTGCTGTTAAGGAGCGTCAG
TCAAAGGTTACCGCAGCCATGTACGAGCGCCAATCTTCATTCACTCAACG
TATCGCGGCTCAGCAAACACATTTGAGTCTTCCATTGTTCCCCACCACTA
CCATTGGGTCTTTCCCCCAGACCAAGGGGATTCGTGTCGCTAGACAGAAG
TTCGGTAAGGGTGACATCTCTGCGGCTGAGTATGAGAGCTTCATCGAAAA
GGAGATCGAACTTGTTGTGAGAGAACAAGAGGCCCTCGGCCTTGATGTTC
TCGTCCACGGAGAGCCGGAACGTAACGACATGGTTCAATATTTTGGAGAG
AGGCTCACAGGCTATGTTTTCACCAACTTTGGATGGGTTCAATCATATGG
ATCCCGTTGTGTCCGTCCTCCAATTGTTGTCGGCGATATTTCTAGGCCGG
CTCCTATGACCGTCAAGGAGTCCAAGTATGCTGCTTCTATCACCAGCAAG
CCTATGAAGGGCATGCTTACCGGCCCGATCACCTGCTTGAGGTGGTCTTT
CCCTCGTGATGATGTTCACCAGTCTGTGCAGGCTGAGCAACTCGCCCTTG
CTCTCCGTGACGAGGTCGTCGACCTTGAGACTGC

Sequences in the Contig:

SY0AAA3YL22FM1 SY0AAA40YD04FM1 SY0AAB15YL03FM1
SY0AAC19YE14FM1 SY0AAC23YC20FM1 SY0AAC24YL24FM1
SY0AAC3YI07FM1 SY0AAC60YM19FM1 SY0AAC7YJ11FM1
SY0AAD4YL09FM1