Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4051
Length(NT) : 1065
Best Gene Model Blast : Link to GSTUMT00002979001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: plasma membrane zinc ion transporter
Accession: ref|XP_731508.1| Score: 413 E_value: 2e-38
KEGG Definition: plasma membrane zinc ion transporter, putative
Accession: afm:AFUA_6G00470 Score: 413 E_value: 8e-39
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG1558 Score: 217 E_value: 2e-18
PFAM Definition: Zip, ZIP Zinc transporter. The ZIP family consists of zinc transport proteins and many putative metal transporters. The main contribution to this family is from the Arabidopsis thaliana ZIP protein family these proteins are responsible for zinc uptake in the plant. Also found within this family are C. elegans proteins of unknown function which are annotated as being similar to human growth arrest inducible gene product, although this protein in not found within this family..
Pfam Number: pfam02535 Score: 151 E_value: 9e-11
Swissprot: Q12436|ZRT2_YEAST
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane
GO:0000007 = Molecular function: low-affinity zinc ion transmembrane transporter activity
GO:0006831 = Biological process: low-affinity zinc ion transport

Sequence:
>Contig4051
TTGGGTGCCCAACGTTTTTATCACTTTCATCGTTTTCTGCCCTCTATTCG
CCACTTGGTCCACAACCCCACAATCCTTACTCCAGAAAATTTCCACCCTT
TAATGAAAATCCTCTGACAGGAGTACCGAAACGTGGGTCAAGTCAGATAT
ATTACAGCTTTCCTTGGAGCTTCGATCCTGCGATCTCCCCTCTCAGGTCA
TCAATCCGTAGCCAGATATAATCTTCTATTTTGGCTTTTAGATAGAGTGC
TTCTTTATTCTCGGATTTCCTAGACCTTCCAATAGAAACCGAGAGGGAGA
AGAAGAAGAAAAAAATCACACCTTGGTTCGGTATTCTTCTCTCACTACCG
GGAAAACTCAAGTCTAGCACAGGAACAATTAATTCCTTCTGATTTGCAAT
TATGAATTGCCCGACCCGAGATCCAGAGCCCACTGGGAATCCATTCTTCA
ACCAGAATCCTCCGGCGCTCGACAAAACTCTAACTACGCGCTCATCCCTC
GTATGTGGCGGTGGCAGTCTTAGCGATGATGAGTATAACCTGGGCTTACA
TATTATGGCATTGTTTCTCGTCCTGGCTCAATCCTCGTTTGCATGTGCGT
TTCCGCTAATTGCGAAAAAATTTCCCCGCCTCCGCATTCCCCCATCCTTC
CTCTTCGGCGCTCATCACTTTGGTACGGGAGTCCTTATTGCAACTGCGTT
CGTCCACCTTCTCCCTACGGCCTTCATCTCTCTCACCGATCAATGCCTTC
CGGGATTTTGGAATAGCACTTATCCTGCTATGGCAGGGGCGATCGCCATG
GTGGCTGTATTCTTTGTTACTATCGTTGAAATGGTATTCACTAAGGGGCT
TTGCAAAGGGGGATGTTCAGACACGAACCAGCGAGATGTGAGATGCGAGG
CTGGTGATAGCTACTGCAATGCTAGGGATGCTGATGAGGAATATGGGGGA
GCGGATAAGACGGGTCAAAAGCGGTGCGACGGCGAAAGGTTGGGGACGCC
TGGGAGCGAGGAGATAGGTGGGAAAGGCGGGGTTGGTAGGATGGGATTTG
GGATGGCTGGGAAAC

Sequences in the Contig:

SY0AAA55YD03FM1 SY0AAC23YC10FM1 SY0AAC44YJ05FM1
SY0AAD10YM24FM1