Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4050
Length(NT) : 770
Best Gene Model Blast : Link to GSTUMT00006691001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_13536
Accession: ref|XP_001585652.1| Score: 409 E_value: 3e-38
KEGG Definition: RAVE (regulator of V-ATPase assembly) complex subunit RAV1/DMX protein, WD repeat superfamily
Accession: aor:AO090012000508 Score: 378 E_value: 6e-35
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0266 Score: 108 E_value: 6e-06
PFAM Definition: No Hit Found

Sequence:
>Contig4050
TTGGGTTTGTGGCTAAGGGAGAACAGGAGGCGTTTGTACAGTTTCATTGC
TTTCCGGGGGGCGTAGGTTCGTCTCCCCTGCCTTTCTCGCGGGGGTGCCA
TGAAAGCAATGGCTGACGAGTGAAAGGTTTAATGGTTTTGGCGCATGTGT
TCGACGGAAGGGTATTCTGGTATGAAGCCAGATTAGACCGATTCTTAGAT
CCTTCGCCCCGCCCGAGGAGAGCTAGCCTTTTGGGGGTATTGGCTGGGCA
TTCCGGGCCCATTGAGACGCTCGTACGGACTGCGGATGGGAAATCCATGC
TGTCGTCGACTCACAAGAATGAGCTTATGGTCTGGTCGCAATCGAAAGGG
GATAATATTGCGCTTTCAAAGCAGAGTTCCATATCACCTGCTAGTCGTGT
GCATAGAGCTGTAATCCTTGATAATGGAAACTACGTGATGACATTACACG
ATGGCCATGTGGTATTATGGGACTCGACTCAATCCGTAGCAAAAGAACTT
GAACGGCTAGATTTCAAAGTCATTGGTGGGAAGATGCTTTGCTTATTACT
ATTACCCGAAGCACAAGATGGGCTAAAACAGTACCATGTCGTTGCGTTGA
GTTCGGAAATGAAGGGAATAGCATGGGGCGTCACGCTACCCCAGAAACCT
AGTGAGATGGCGAATGGAATCAATGATATTCGGCCAACGGTTCGCGAGTT
TGCTACGTTTGCACTGGATATGAAGGAGGATCTGTTAATGATTCTGCCCG
TTGATCCTGTGGGCTGGAAT

Sequences in the Contig:

SY0AAC16YD16FM1 SY0AAC23YB23FM1