Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig405
Length(NT) : 648
Best Gene Model Blast : Link to GSTUMT00005851001 E-value : 3e-76
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein BC1G_03006
Accession: ref|XP_001558342.1| Score: 226 E_value: 3e-17
KEGG Definition: hypothetical protein
Accession: ang:An08g05820 Score: 223 E_value: 4e-17
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning, Signal transduction mechanisms].
Kog Number: KOG0082 Score: 133 E_value: 6e-09
PFAM Definition: G-alpha, G-protein alpha subunit. G proteins couple receptors of extracellular signals to intracellular signaling pathways. The G protein alpha subunit binds guanyl nucleotide and is a weak GTPase..
Pfam Number: pfam00503 Score: 142 E_value: 5e-10
Swissprot: Q9HFW7|GPA3_NEUCR

Sequence:
>Contig405
TTGGGTTTAACCAAGTCAACAGGGCTCATCTAAACCTTTATCCACATCTC
ACACAAGCAACAGACACGTCGAATATCCGATTGGTATTTGCGGCGGTGAA
GGAGACAATATTACAGAATGCTCTCAAGGAGTCTGGCATATTATGATTAA
AATGAGTGGATCCATATTTCTCTCATTAATTCTAACGATCCTTTGTACAA
AAACGTTTGCTTTATTAGGTATTGGATTTTTATTTTTTTCCCCTTTTGCT
CGATTTCGTTACCCTTCACTGTTACAGTTTTTTTTTTTGTCTTCATACTA
TTTTCCCGCTTTTGGTTTTCCCTTCAAGTCGAGTACGGGCGGTATGCACT
GGATTGTGCATTCTGAAAGAAAAATGGTGAGATATTGTGTCACATCTTGA
CTGGGATTGTTATTGGGAATTGGCTACTGCTTAATGGTGGCTCTGGTATT
GCTCCTTTTCCTTATCTTTTTCTCTCTTTCGGTATGGGTACAAAGCACGG
GAGCATTTTTGTGAATTGGTTCGCGTGGTTTGTCAAGAATCGGAGTTTCG
GCGAGAGCTATTGGCACTCGCAATTGTGTATAGTTTTCCTTCATAGCGTT
CAAACCCCCCCTGTCCCCATTTATTTCTCCTCTGTCATCTGTCTTGAC

Sequences in the Contig:

SY0AAA22YP22FM1 SY0AAA34YA23FM1 SY0AAA35YA23FM1
SY0AAC32YL18RM1 SY0AAD17YB10FM1 SY0AAD58YN08FM1