Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4049
Length(NT) : 776
Best Gene Model Blast : Link to GSTUMT00005395001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein An03g04960
Accession: ref|XP_001390377.1| Score: 1073 E_value: 1e-115
KEGG Definition: hypothetical protein
Accession: ang:An03g04960 Score: 1073 E_value: 1e-115
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0667 Score: 760 E_value: 1e-81
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 312 E_value: 1e-29
Swissprot: Q09690|POM1_SCHPO
Gene Ontology:
GO:0000935 = Cellular component: barrier septum
GO:0051285 = Cellular component: cell cortex of cell tip
GO:0004674 = Molecular function: protein serine/threonine kinase activity
GO:0051519 = Biological process: activation of bipolar cell growth
GO:0000753 = Biological process: cellular morphogenesis during conjugation with cellular fusion
GO:0007105 = Biological process: cytokinesis, site selection
GO:0007163 = Biological process: establishment and/or maintenance of cell polarity
GO:0006468 = Biological process: protein amino acid phosphorylation
GO:0008104 = Biological process: protein localization
GO:0007165 = Biological process: signal transduction

Sequence:
>Contig4049
TTGGGAGGCGGATTGCTAGCAAGCGCAAGAATTTGGATGCCATGGCTCAA
GAGTTGGAGGAGTTGAAACGTAGGGCTGTGCCAAAGGACAGAATGTCTGC
GCCGCAGGCCCTTCGGACTATCGCTCTCAACATCTATGAGCGTGGAGAGA
TTGTGGATTTCAAAGAGGTTTATTTTACAGGAACTCCGGGCGCAAAGAAA
CATGTTGGGGATCTCAATTCAAGTGCTCTGCCGAACTTTGGATATGATGA
CGAGCGAGGCGACTATACTATCGTGAAGGGAGACCATCTAGCTTACAGAT
ACGAGATTGTCGACATCCTCGGAAAGGGTAGTTTCGGTCAAGTTGTTAGA
TGCGTTGATCACAAAACAGGAGGACTTGTAGCTATCAAAATCATTCGGAA
CAAAAAGAGATTTCATCAACAGGCCTTAGTCGAAGTCAATATCTTGCAGA
AGTTGAAGGAATGGGATCCTCACGGAAAGCATAGCCTTATCAACTTTACG
CAATCTTTCTATTTCCGTGGACATCTGTGTATCTCAACTGAACTACTAGG
CATGAATCTCTACGAGTTCATCAAATCCAATGACTTCAAAGGGCTCTCCT
TACGACTTATCAGAAGGTTTACCAAGCAAATGTTGAGCAGCTTGGTCCTC
CTCAAAGGGCATCGTGTTATTCATTGTGACTTGAAGCCAGAGAATATATT
GCTGGCCCACCCTGCTAAGTCGGAGATTAAAGTCATCGATTTTGGAAGTA
GCTGTTTTGAACATGAGAAAGTGTAT

Sequences in the Contig:

SY0AAA56YP22FM1 SY0AAC23YA23FM1 SY0AAD46YJ02FM1