Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4047
Length(NT) : 2982
Best Gene Model Blast : Link to GSTUMT00001342001 E-value : 0.0
Numbers of ESTs : 43

Blast Results:

Nr Definition: elongation factor 2
Accession: ref|XP_001245593.1| Score: 3804 E_value: 0.0
KEGG Definition: hypothetical protein
Accession: ang:An02g05700 Score: 3646 E_value: 0.0
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0469 Score: 3891 E_value: 0.0
PFAM Definition: GTP_EFTU, Elongation factor Tu GTP binding domain. This domain contains a P-loop motif, also found in several other families such as pfam00071, pfam00025 and pfam00063. Elongation factor Tu consists of three structural domains, this plus two C-terminal beta barrel domains..
Pfam Number: pfam00009 Score: 445 E_value: 2e-44
Swissprot: Q96X45|EF2_NEUCR

Sequence:
>Contig4047
TTGGCCCCATCCTCCATCTCTTCCCGCCCCCTGGTCTTTATCCTCCTCTC
CATCGACCATCCACTCGACCGGACGACTTGCTCTTCCTAAGTCTTCCCTT
GCGAGAGAGGAGCTCTTTTTTTAAAAAAAAACCTCACACAAAAGCTTTTT
ACTTGCCCTTCGAGACAAAAAATCAGACAAAATGGTCAACTTTACCGTCG
AACAGATCCGTGAGTTGATGGACCATGTTACGAACGTCCGCAACATGTCC
GTTATTGCCCACGTGGACCACGGAAAATCCACCTTGACCGATTCTCTCGT
CCAGCGGGCGGGAATTATCTCTGCCGCGAAAGCAGGTGAGCAGCGGTTTA
CGGACACTCGCCAGGACGAGCAGGACCGTTGTATTACCATCAAGTCTACC
GCCATCTCTCTATACGCCGAACTCTCGGAGGAGGACTGCAAGGACATTAC
CCAGAAAACTGAAGGAAACCACTTTTTGATTAACTTGATCGATTCCCCCG
GCCACGTCGATTTCTCCTCTGAAGTTACGGCCGCGCTCCGTGTCACTGAT
GGTGCTCTCGTTGTCGTCGATTGTGTTGAAGGTGTCTGTGTCCAGACAGA
GACTGTGCTGCGTCAAGCTCTTTCCGAGCGTATTAAGCCTGTCTGTATCA
TCAACAAGGTCGACCGTGCTCTTTTGGAGCTGCAGGTATCAAAGGAGGAC
TTGTACCAGTCTTTCTCCCGAACAGTAGAGTCCGTAAACGTCATTGTCGC
CACCTACTTCGACAAGGCTCTTGGTGATGTTCAGGTTTACCCTTACAAGG
GAACCGTTGCTTTCGGTTCAGGTCTTCACGGCTGGGCTTTCACTGTCCGC
CAGTTCGCCGGACGCTATGCCAAGAAATTTGGCGTTGACAAGAACAAGAT
GATGGAGCGTCTATGGGGTGACAACTTCTTCAACCCAAAGACCAAGAAAT
GGACCAAGACCGAAGTCCACGATGGCAAGCCTTTAGAACGTGCCTTCAAC
CAGTTTATCCTTGACCCCATTTTCAGAATTTTCTCTGCTGTCATGAACTT
CAAGAAGGACGAGATCCCAGTCCTACTTGAGAAGCTCGAGATCACCCTCA
AGTCCGATGAGAAGGATCTCGAAGGAAAGGCTCTCCTTAAAGTTGTTATG
CGAAAATTCTTGCCTGCCGCTGACGCTCTCATGGAGATGATTGTCATGCA
CTTGCCCTCTCCCGTCACCGCCCAGAAGTACCGTGCCGAGACTCTGTATG
AAGGCCCTTCTGACGATGAGGCCTGTATTGGTATCCGGGATTGTGACCCC
AAGGCTCCTCTCATGCTGTACGTCTCCAAGATGGTACCGACGTCCGATAA
GGGCCGTTTCTACGCCTTCGGTCGTGTCTTCGCTGGTACCGTCAAGTCCG
GTCTTAAGGTCCGCATTCAAGGCCCTAACTACACTCCCGGCCGCAAGGAG
GACCTGTTCATCAAGGCTATTCAGCGCACAATTCTCATGATGGGTCGTTA
TATCGAGCCTATTGAGGACGTCCCAGCCGGTAACATTGTCGGTCTGGTTG
GTGTTGACCAGTTCTTGCTTAAGTCTGGTACTCTCACCACTTCCGAGACT
GCCCACAATTTGAAGGTCATGAAGTTCTCTGTATCCCCCGTCGTCCAGGT
TGCCGTCGAGGTCAAGAACGCCAACGACTTGCCCAAGTTGGTTGAAGGTC
TTAAGCGCCTCTCCAAGTCCGACCCTTGTGTCTTGACTTACATCTCGGAG
TCTGGTGAGCACATCGTTGCCGGTGCCGGTGAATTACATTTGGAGATTTG
CTTGAAGGATCTTGAGGAAGATCATGCGGGTATCCCGTTGAAGATTTCTC
CTCCTGTCGTCTCGTATCGTGAGACTGTTGCCGGCAATTCGAGCATGACC
GCCTTGTCAAAGTCACCCAACAAGCACAACCGTCTCTACGTCGCTGCTAC
CCCGCTTGACGAGGAGGTTGCTAAGGATATCGAAGCCGGGAAGATTGGTC
CCCGTGATGACTTCAAGGCCCGTGCAAGAATCCTTGCTGACGAACACGGA
TGGGATGTTACTGATGCCCGTAAGATTTGGTGTTTCGGTCCTGACACCAG
TGGCGCCAACTTGCTCGTTGACATGACTAAGGCCGTACAATACCTCAACG
AAATCAAGGATTCCGTCGTTTCTGGGTTCCAGTGGGCTACCCGTGAAGGC
CCTATCGCCGAGGAGCCTATGAGAAGTGTCCGTTTTAACGTGCTCGACGT
TACTCTGCACGCTGATGCTATCCATCGTGGCGGTGGGCAGATCATCCCGA
CTGCTCGTCGTGTCCTGTATGCTGCTACGCTGCTCGCTCAGCCTGGCCTG
TTGGAACCCATCTACCTTGTCGAGATCCAGGTTCCTGAGCAAGCGATGGG
TGGTATCTATGGTGTCCTGACCCGAAGAAGAGGTCACGTTTTCTCTGAGG
AGCAGCGTCCTGGTACCCCTCTGTTCAACGTCAAGGCTTACTTACCTGTC
AACGAGTCCTTCGGTTTCACCGCCGACCTTCGTTCGCACACTGGCGGGCA
AGCTTTCCCCCAGTCTGTGTTTGACCATTGGGCCGTCCTTCCTGGTGGTT
CGCCTCTTGACGTCACCACTAAACCGGGTCAGATTGTCCAGGAGATGCGC
AAACGCAAGGGTATCAAAGCTGAGGTTCCCGGCATTGAGAACTACTATGA
CAAACTCTAAGCAAATTAAAAAAAAGGGAAAAGGGGAAATTCTCAACGGC
GATACGAGGGTTGGTATTTCTTTAACTGGGTTTTCTTATGTTTGTTTTCC
AATTGGTTCTTGTTCATTTAGTGTTACAATAAGCTAGGTCTTTCATATTC
TAGTAACCGTCGTTGTCAAATAAAGGGACGGAAGACCCCCAATTATGGGG
TCTCATACTATTTTCGCTGCGTTCAAATTTTTTTTTTTCCTAGCCTGTCT
CTAATACCCTTTGGACAGCGATTGTGCCATCA

Sequences in the Contig:

SY0AAA12YN18FM1 SY0AAA15YC08FM1 SY0AAA16YF16FM1
SY0AAA19YN04FM1 SY0AAA21YF15FM1 SY0AAA32YO16FM1
SY0AAA34YG16FM1 SY0AAA42YA05FM1 SY0AAA42YM14FM1
SY0AAA43YO15FM1 SY0AAA43YP15FM1 SY0AAA46YD01FM1
SY0AAA53YH18FM1 SY0AAA58YM11FM1 SY0AAA60YP12FM1
SY0AAA63YD19FM1 SY0AAB15YI15FM1 SY0AAB16YO13FM1
SY0AAB20YB06FM1 SY0AAB22YG03FM1 SY0AAB22YO08FM1
SY0AAB37YB08FM1 SY0AAB40YD20FM1 SY0AAB42YJ22FM1
SY0AAB43YE24FM1 SY0AAB53YJ07FM1 SY0AAB55YB18FM1
SY0AAB55YM05FM1 SY0AAB8YE16FM1 SY0AAB9YF11FM1
SY0AAC22YP18FM1 SY0AAC25YB16FM1 SY0AAC26YH09FM1
SY0AAC29YE16FM1 SY0AAC5YK21FM1 SY0AAD16YE17FM1
SY0AAD16YP11FM1 SY0AAD18YL07FM1 SY0AAD19YO06FM1
SY0AAD21YB09FM1 SY0AAD31YC10FM1 SY0AAD41YC23FM1
SY0AAD59YG07FM1