Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4046
Length(NT) : 584
Best Gene Model Blast : Link to GSTUMT00007587001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE63146.1| Score: 186 E_value: 1e-12
KEGG Definition: ankyrin repeat
Accession: aor:AO090113000090 Score: 186 E_value: 6e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4046
TTGGCATTTGACCCTCGGGAGAGAAGGGTAGTCCTCAAGCTCCCCAACCC
GTCTAATCCCTCTATTCTTCCCTGGTCGAAAATTATCAATAGAAGCATCA
AAAAACACATTCGGTTCCTACCTCGCCAAACAAAACTCCTCTCTATTCAG
AAGTCAGTCGATAAAATGGGCAACTTTTTCTCAAGCAATTCTTCTGAGGT
CCAACGCCCAACGCAAAGATCTGTCGGTGAACAGCAATATTGCCGGTGAC
CTTAGTGGGAATAGCGGTACTGGTAATCAAATCAACTGTGGTAACACTAC
GAACATTTACCAAGGGGCAACGAACTCGTCCGGGAATCAGACCGAAATTT
TGCAATGCTTATACAAGTCTGCATACGAGTCGCACCGAAGTCGGGTTCGT
GAGCCAGCAGAGGGAAAATGCACCTGGGTTACGGAACATCCAAAGTACAT
GGAGTGGGTAGGGAAAAAGGCGGCGGCTCTCCTTTGGCTATCGGCGGACC
CGGGTTGCGGAAAATCTGTCATGGCTTCATTCCTCGTGGGTCATCTGAAA
GCCCGAACTGATGCTATCGTTTGCTACTTCTTCT

Sequences in the Contig:

SY0AAA54YJ20FM1 SY0AAC22YP14FM1