Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4045
Length(NT) : 953
Best Gene Model Blast : Link to GSTUMT00009985001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_07490
Accession: ref|XP_001553930.1| Score: 390 E_value: 7e-36
KEGG Definition: pentatricopeptide repeat protein
Accession: afm:AFUA_5G10660 Score: 334 E_value: 1e-29
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4045
TTGGGATTCAAGAAGGTGTACAACCTAGTACCACCACCTATAACCACGTT
CTCGTTGCCCTCATACAAACCGGAGCCGGCGGCATCCCTCGGGTCCTGAG
TGTTTACCAGGACATGCTCAGGAACAAAGTCCTACCTAGCACTGTCACAT
ATTCCATCCTAATCGACTACCTTGCCGCAAGCGGTAAATCCTCGTTGCAG
TTTGCTCGGCGAATTGAAGATGACATCCTGAGATTCGGATTTGTCGTCCC
ATCCCGGAGGCGGGAATTGGATGAGATCCGCTCGCAAAAGTCTTTAGACA
TGGCTTTGGACATATTTTACGCTAGCACTGAAGTCCGGGTGGAGCGTACC
TTTTCTGAACCCGTATATTCCATTCTTATTGAGGCATGTGCTGAGAATGG
CCGTGAGGAAGATATGCTCAAGGTCTATACACATATGGAATTGCATGACG
TGTTGCCGAGCTTGGACACTACGCTTTCTCTTATAAAGGGATTTGGGAAG
GCTGAAAATATTTGCTCTGCTGTCGAGACATACAACAACTACTGTGCTCT
GGATACATCAAAAAAGCCGGCAAATGTCGATGAGCGATATCTGGTCTACA
AGGCATTGATTCTTGCTTACATGGAGGCTGGTGATCCTGCTGGTGCGCTG
TCATTCTTGGAGAAAATTGTCGGTACTAGCAAGGACCCTCATCGCTCTCA
ATGGTTGGCGGAGGCCATAATCAAAGGTTTCCTGCAGCGGAGTGATTTGG
GGTCTGCCAAGGAGTGGATTGCGGGCCGAATGGCCGGGACATCGGAATAC
ATTGGACTGTCAAGGGTTCTTATTGGAGTTGCGGATTTGGGGGATTATGG
GCTTGCGGATCGGCTTTATTCGGAATTCATGGATTATGTCCGTCTCCATA
GTATTAACCATTCCAGCACCTCAATTGCTCAGATGGCTTTTTTGAATCTC
TGC

Sequences in the Contig:

SY0AAB44YD08FM1 SY0AAC22YO18FM1