Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4044
Length(NT) : 1511
Best Gene Model Blast : Link to GSTUMT00001431001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein BC1G_11654
Accession: ref|XP_001549622.1| Score: 1444 E_value: 1e-158
KEGG Definition: hypothetical protein
Accession: fgr:FG05329.1 Score: 1394 E_value: 1e-152
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2220 Score: 453 E_value: 2e-45
PFAM Definition: BRO1, BRO1-like domain. This domain is found in a number proteins including Rhophilin and BRO1. It is known to have a role in endosomal targeting. ESCRT-III subunit Snf7 binds to a conserved hydrophobic patch in the BRO1 domain that is required for protein complex formation and for the protein-sorting function of BRO1..
Pfam Number: pfam03097 Score: 415 E_value: 3e-41
Swissprot: Q4IBS9|BRO1_GIBZE

Sequence:
>Contig4044
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCTGCTTGCGAAACTGGCTGCCCAAGCTGGATTTTTGTACGCCC
AGGCTGTCGAAGGTGTCCAGGAGAATGTCCAGAAGGGCATCTTCGAGCGA
GTCTGGCTATTGCTATGCCAGGTTAAACAAAATTTCATGGATTCATTAGC
TCAGTATCTCCAAGCACTAGCGGATAGTGAAGGTGGTAAATACGGACTTG
CGATTGCTCGCCTGCATTTGGCTGAAGATTTGGCCAAGGAATCGCTTCGA
ACATCACAGTCGTTCCCTAATTCTCCTCCAGCTACCTCTAATTTGTCCTC
AGAAACTGGTCCTGCTCTAGTCCAAATTAATAAAAGACACCTAGCTCTTG
TCCAGGAAAAACTCGTTACTTTGATTAAGGAGAACGATTTTATCTACCAT
CAGACGGTCCCAGCCGAAGCAGCAATTCCCGTGGTTCCAAAAACGGTAGC
GGCAAGGGCAATTCCTGTACAGGAGCTATACCAAGGAGATGATATTAACC
GTATCATTGGCCCCGATATCTTCCAGAAGATTGTGCCTATGAAAGTCACC
GAGAGCGCATCTTTATACGACGAGGAGAAGGCTAAGCTGGTCCGCGCGGA
GACAGAGCGGGCGGACTTAGCAAATGCAGAAATGGTTGCGGCCTTGGACT
ACTTGAAGCTACCCGGATCGCTAAAGCTGCTTAAAAATGGCTTTGAGAAT
GAGATTGAGGTGGACGACGAGTTCCGGACATGGTGTGATGATATCGCACA
CAAACCCGAAACTTTGGGGGAGAGGTTTATCGGTTTAAAGAAGGATAAAA
AGAGGATTGTGGAGATCCTGGATCGATCTTCAAAGAGTCTGGATACTGAG
GAGAGCGTGTGTGAAAAAATGAGGACGAAATATCTAGATGACTGGACGCA
GCAACCTTCAAGTCGACTCACACAGACTCTCCGAGCGGATATTAGGAGCT
ATCGAGAGGCTATTGATGAAGCTGTGAACAGCGACAATCTGCTTTTTTCC
CAGTACCGAGGGGTCGAGGGAGAGATAGAGGAAATGAAGAATGCGGGCGA
GAGAGCTGAGGAAGGAGCTGTTGACGGCTTATGGGTTAGTAAGGCTGGTG
TTGCCAATGGTGGCTTTGGTGGAGATCGGGGTGGAGAGACCCTTCTAGAT
GTTGACGAAGGGGACTCTGGAGTTACCGTTTTGGAACAGATCGAGAGAGT
AGAGGGACTGCTTAAGAAGCTCAATCTGATCAAACGAGAGCGGGCCCAAG
TCTTGAAGGATTTGAAAGAAAGGGTTCATACCGACGATATTTCGAATGTT
TTGATCCTCAATCAAAAATCAATTCAAAATCTCGAGCCCCAATTGTTTGC
GACAGAATTGGAGAAGTTCCGCCCACATACAAACAGGTTGCTCACAGCTG
CGCACAAACAGTCGTCATTGATGAAGGACTTGACATCAGCTTATGGTGAT
CTTTTGCAAGA

Sequences in the Contig:

SY0AAC22YO13FM1 SY0AAC38YB12FM1 SY0AAC38YE20FM1
SY0AAC48YJ22FM1