Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4043
Length(NT) : 2118
Best Gene Model Blast : Link to GSTUMT00009297001 E-value : 0.0
Numbers of ESTs : 85

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE61523.1| Score: 1443 E_value: 1e-157
KEGG Definition: asparaginase
Accession: aor:AO090102000492 Score: 1443 E_value: 1e-158
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0503 Score: 516 E_value: 9e-53
PFAM Definition: Asparaginase, Asparaginase..
Pfam Number: pfam00710 Score: 592 E_value: 1e-61
Swissprot: O88202|LPP60_RAT
Gene Ontology:
GO:0004067 = Molecular function: asparaginase activity
GO:0004622 = Molecular function: lysophospholipase activity
GO:0006528 = Biological process: asparagine metabolic process
GO:0006644 = Biological process: phospholipid metabolic process

Sequence:
>Contig4043
TTGGAGTGAACCTTACATACTCGGACCCACAAACCTGATAGCGACAAGAT
AAGGAAGCTATGACTTTTCACCTGACAACACCAAGTCCGCACAACTCGAC
TCCTAGTAGCTCAACCACCAACAGTACGCCCGCGTACGGAAGTCCCCAAC
ATGGCTCGCCAACTCAGTCAAGCTTTCCTACCTTTGATGGCCCTGGGGAA
GACGGCCATTCCGTTGCGGAGAGCAGGGTTTTAATAATCATGACAGGAGG
GACGATATGCATGCGTATGGGAAAAGACGGTTACGTTCCCGTAAGTTTGC
GTTCCCCTTTTTCCTTTTCCCTCTCTTGTGGTCCAACCGAAAATACTTTT
GGTGATGGTGTTGCGTCATGGCATTGGCAACATGGATTGGAAATTCGCAA
ATGAGCTGCCTTGGAACAATTGTTGTTGTTCCCTGGAGGAGAAGCGCCCG
TCGCTCCACAAGACTGTGAGCTGGGCACGCCACTGGCTTTCTCGATGCCT
ATCTCAAACCCAGGCCGTCTTTCAATGATGGCTCGCCTACTAAATGTCTT
CCTGTCATGACTGATGACGAGACGGAAGTGATGCTCGAATCTTTGCGCAC
CCCTCCTTCCAAACATGCTCGCCGCATTCGATACGCAATTCTTGAGTTCA
ACCCCCTCCTTGATAGTTCGAGTATCAACGCCAAAGGTTGGGGTGAGATT
GCAAAATCAATAAAACGCAATTATACACTTTTTGATGCGTTTGTGATCTT
GCACGGTACCGATAGCTTGGCTTACACAAGCTCTGCACTGAGCTTTATGA
TCAGTAATTTGGGGAAATCGATTATCCTAACAGGTTCCCAAGCACCAATG
GCGGAGCTCCATAACGATGCTACAGACAATCTTCTCGGAAGTCTCATTAT
TGCTGGCCATTATATGGTACCTGAAGTTTGCCTTTTCTTTAACCATAGGC
TATTTCGTGGAAACCGAGCGACGAAGAGCAATGCTCACGACTTCCGTGCC
TTCTCATCTCCAAATTTCAACTCTCTTGGGAAGGTTGGAATATCCACAAA
TATAAAGTGGAATTTGGTCAACCGTCCATCTACTCTTGCGCCCTTTTCCG
TACAGACAAGTCTATCCACAGCTCATGTCGCTTGCTTGCGAATCTTCCCT
GGCATCCTCCCCGAGATGATTGAAGGCATCCTAGCGTTGGAGAACTTGAG
GGGATTAGTCCTTGAGACCTTCGGAGCGGGCAATATGCCCGAAGACGAGC
GGTTGATGACTGTGTTGAGGAAGGGAGTTGATAATGGAATTGTCATTGTC
AATGTGACCCAATGCATAACCGGAAGCGTTAGTCCCCTATATGCTTCTGG
CACAGCATTAGCCAGAGCTGGCATTGTTTTTGGGCTAGACATGACCACCG
AAGCTGCGCTCACGAAACTTTCCTGCCTCCTGGCGAAACCCGAACTCACC
GTTACTGATATTCGTCGACAGATGTCCTTATCCTTACGCGGCGAGCTAAC
GGAACAATCTGCAACTAGCTTTTCGCATCCGAACTCGTTGCTACCACCAA
AGCTCTCGCGATTGACCGCTTTGGCCTATGCCATAAAAAAGGGGGACCAA
AAAAGCATTTCATCTGTATTGAAGGAATCAAACGAGTTTTTGCTGAATGA
ATTTGATTACTCGGGGAACACGCCGCTGCACCTGGCCTCCACGTGCCGTA
ATATTGACATACTCCGTGATTTTCTCTCTCAAGGAGCTTCGGTTCATTTG
CGTAACGGTGATGGCAGAACACCCCTATTTCTGGCGGCCGATGCCGGTAT
TGAAGTCAACGTCTCGTTACTAAGGGAGAGCGGGGCACACCTACACACCG
AGGAGGTGGAACATGCTAAATTGAAGCTCAAAACCCTCAAATGGGATCAA
GAAAGTAGACCGAATGAGTTTACCAAAATTACCAAACTGAGGTGTTGGGA
GCTTGCAGGTGCCTAACAAGGTATAGAACTACTCCCCCAGAAAACGATAG
CCCTTATTCCTTTTTTTGGAATTTTTTTGCACCCCCTGTTCGTGCCCTGA
TATGTCCTTATCATTCGGCATCGGTATCTTCCTTCCCCACCTCCCCTCGC
AGTTACTTTTTCTACTCG

Sequences in the Contig:

SY0AAC10YF15FM1 SY0AAC13YD15FM1 SY0AAC14YJ04FM1
SY0AAC14YP11FM1 SY0AAC15YA06FM1 SY0AAC16YH18FM1
SY0AAC1YP17FM1 SY0AAC22YO11FM1 SY0AAC23YD01FM1
SY0AAC25YF05FM1 SY0AAC25YG02FM1 SY0AAC25YG08FM1
SY0AAC25YP15FM1 SY0AAC26YO16FM1 SY0AAC27YG21FM1
SY0AAC29YA05FM1 SY0AAC2YH18FM1 SY0AAC2YP06FM1
SY0AAC33YP23FM1 SY0AAC36YF12FM1 SY0AAC37YG07FM1
SY0AAC37YG18FM1 SY0AAC38YM20FM1 SY0AAC38YN21FM1
SY0AAC3YP01FM1 SY0AAC41YC11FM1 SY0AAC41YH12FM1
SY0AAC41YM01FM1 SY0AAC42YI03FM1 SY0AAC43YF04FM1
SY0AAC48YJ19FM1 SY0AAC49YM05FM1 SY0AAC4YL20FM1
SY0AAC50YM13FM1 SY0AAC51YO10FM1 SY0AAC53YO17FM1
SY0AAC53YP10FM1 SY0AAC56YA19FM1 SY0AAC59YN11FM1
SY0AAC5YH15FM1 SY0AAC60YH06FM1 SY0AAC61YB04FM1
SY0AAC61YE19FM1 SY0AAC62YJ20FM1 SY0AAC62YP04FM1
SY0AAC7YF02FM1 SY0AAC9YG10FM1 SY0AAD10YN12FM1
SY0AAD16YK05FM1 SY0AAD18YO23FM1 SY0AAD1YA03FM1
SY0AAD24YM17FM1 SY0AAD26YE12FM1 SY0AAD32YC11FM1
SY0AAD33YO04FM1 SY0AAD35YL10FM1 SY0AAD36YB02FM1
SY0AAD36YP16FM1 SY0AAD3YC23FM1 SY0AAD40YH07FM1
SY0AAD40YN07FM1 SY0AAD42YH21FM1 SY0AAD42YI10FM1
SY0AAD42YM23FM1 SY0AAD43YH13FM1 SY0AAD43YM22FM1
SY0AAD43YP21FM1 SY0AAD45YE13FM1 SY0AAD46YA13FM1
SY0AAD46YA21FM1 SY0AAD47YE08FM1 SY0AAD48YD05FM1
SY0AAD48YP19FM1 SY0AAD49YB18FM1 SY0AAD50YN17FM1
SY0AAD53YM06FM1 SY0AAD55YA01FM1 SY0AAD56YL05FM1
SY0AAD58YH12FM1 SY0AAD5YH14FM1 SY0AAD5YL16FM1
SY0AAD61YE24FM1 SY0AAD62YE22FM1 SY0AAD62YI01FM1
SY0AAD8YB21FM1