Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4042
Length(NT) : 679
Best Gene Model Blast : Link to GSTUMT00000647001 E-value : 1e-141
Numbers of ESTs : 4

Blast Results:

Nr Definition: manganese superoxide dismutase
Accession: gb|AAO47725.1| Score: 356 E_value: 4e-56
KEGG Definition: Mn superoxide dismutase SodB [EC:1.15.1.1]; K04564 superoxide dismutase, Fe-Mn family
Accession: afm:AFUA_4G11580 Score: 349 E_value: 2e-54
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG0876 Score: 341 E_value: 5e-33
PFAM Definition: Sod_Fe_C, Iron/manganese superoxide dismutases, C-terminal domain. superoxide dismutases (SODs) catalyse the conversion of superoxide radicals to hydrogen peroxide and molecular oxygen. Three evolutionarily distinct families of SODs are known, of which the Mn/Fe-binding family is one. In humans, there is a cytoplasmic Cu/Zn SOD, and a mitochondrial Mn/Fe SOD. C-terminal domain is a mixed alpha/beta fold..
Pfam Number: pfam02777 Score: 290 E_value: 4e-27
Swissprot: O96347|SODM_CHAFE
Gene Ontology:
GO:0005759 = Cellular component: mitochondrial matrix

Sequence:
>Contig4042
TTGGGCCCCCTCAACCGTACAAAATGTCTCTCCTCCGCATCGTCCGCCCT
ACAATTGCCCGTCGCAGTCTCCTAACATCATCAATCCGCTACAAGCATAC
CCTCCCGGACCTTCCGTACGACTATGCAGCCCTCGAGCCGGCCATTTCCG
GGAAGATCATGGAGCTACACCACTCCAAGCATCACCAAACATACGTCAAC
TCCCTCAACGATGCTGAGGAGAAGTACGCATCAGCGGTATCAGCGAACGA
TGTTCAGAGACAAATTTCTTTACATTCATTGTTGAGGTTTCACGGAGGGT
CCGTTCAACCCCCCCTCCCCTTCCCCACATTTTTTTCTTCCTCCGAGGCC
ATGTTGATATGCAAACAGTGGTCACATAAACCACACCCTCTTTTGGGAAA
ACCTAGCGCCAAAGAGCTCCGGTGGAGGAGAGCCCCCGAGCGGAAACCTC
GCCGGTGCAATCACCAGCACGTATGGCAGTGTCGAAAATCTCAAGAAGAT
GATGAATGCTAGCCTTGCTGGAATTCAGGGCAGCGGATGGAGCTGGTTGG
CTAAGGATAAGCATACCGGGGCTCTGCAGGTTATCGCCATGCCCAATCAA
GACCCCGTGGTGGGAAAGTACGTTCCGTTGCTGGGGATTGATGCTTGGGA
GCACGCTTACTACCTTCAATATCAAAACC

Sequences in the Contig:

SY0AAC22YB20FM1 SY0AAC22YM13FM1 SY0AAD33YC13FM1
SY0AAD34YC01FM1