Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig404
Length(NT) : 2486
Best Gene Model Blast : Link to GSTUMT00011229001 E-value : 0.0
Numbers of ESTs : 19

Blast Results:

Nr Definition: hypothetical protein An08g05540
Accession: ref|XP_001392671.1| Score: 702 E_value: 2e-71
KEGG Definition: hypothetical protein
Accession: ang:An08g05540 Score: 702 E_value: 8e-72
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2306 Score: 399 E_value: 4e-39
PFAM Definition: No Hit Found
Swissprot: Q5FW46|K1370_XENTR

Sequence:
>Contig404
TTGGCCTTCCTACTTATTCTCACCTCATGGAGTTCCACACCCCGGCCCCT
TCTTTTCCTTTATCCCTTCGAAATACTTGCACCGCTGCTCACCCTCCTCC
TCCCCAATGCCTATACCCCTCGTTTACAACACCGAGCACCCCTCGCCGCC
ACAGTCTTCTTCCGTAACACCCGAAGAGGTAAGGGAACTTCCTCCTCGGA
CACCCCAATTGACAATGCACACCAAATATTTCAACTCGACAACTTCACCC
TCCTCACCTCCCCTCTCTCCAGCCACAACCGTGAATGGGGTAACGGATAG
AGCTGAGCTTATCGAGAGAATAAAAGCTGGCCAAACTCCTACTTGGGTCC
CTAACCGATCGCATTCGAATTATTACTCTAACCACAGCCCTTTGGAAACA
CTTTTTATCGACGAACACCCTGACCGTCCCCAGTCTGCTCTCCACCAAGG
TGTCTTTACGAATAACGAGTCAAGGAATTTTCAACCGTACCATCCGTCGC
CTACGTTCCCTTCCGCTTCATCCTTTCTAAGCAGTCCGAGCACGGGTTAC
AGTGAATCGTCTCTTACCACATCCTCCCCGTTCAATCGTTATGCTTCCGA
GCTCTACCAGGCCAGAACAAAGCATAAAGGCCTTCCGTTCTCTTCCAACT
TCGTCCTGAAAGCTGCGACGTCACCGCTGGTTCACTCTTCGAACCCTGGC
AATGACAGCAGTAGCAACGAGGGCTCACCCGCTTTGACAGCTGCGGGCGC
AATTGACATTCAATATTCCTTCCCGGGTAGAGAAGGTCGACGTGTCTCCC
TTCCACCGTCGTCGCTTTCCTCTCTACAACTATCACCGACTACCCCGTCT
TCATTACGTCGTCCAAAGGGGGCTGGATGGGGGGATGGTCAGTCGACTTC
ACCACCTCTTGCAACCCGTCATGTTCGTCGTTTCTCGGGATTTGGGGGTT
CAACATCGGATTTGCCGTTTGGGGGTTCTTTGGTGGGATCATTTGAGGAG
TCTATACTCAACGGCCGTATGTCGACTACTCCGTCAAAACCTCTCAATTT
CGTTGCGCAGATCGGGGTCCTCGGTCTCGGAAAGTGCAAGCCGTCACTAA
GGTGCCCGACCCATGTCACTCTTCCGTTCCCGGCCTATTTTTATGCCCTT
GGCGATTACGACAGCCCTTCGCCATATGTTGGACAAATTGACCTCGACAC
AGCCCTGAATATTGCAAACGGAAGGTCTTCGAAGGCTCCTCCAGGCGTTG
GGGGGGCATACCGTATTCCGCAGCGTGGACAGCTCCAGATTGTTATCAAA
AATCCGAATAAGACCGCGGTGAAACTTTTCTTGGTTCCGTACGATTTGAA
GGATATGGAGGCAGGCTCGAAGACGTTTATCAGGCAAAAAAGCTATTCCG
TTGGAAACCCGCTACTCTCCGACTTCGCTGGAAACATTCCGGTGGCTATG
AAGAGGGAGAAGGAGAAGGACTCGTTGCGTTACCTAATTCACCTGCACAT
TTGCAGTCCGAGCAGGAGTCGCTACTACTTACATAGGTCGATCAGGGTGG
TATTCGCGAATAGGGTCCCGGATGGCAAAGAAAAGCTGAGGAATGAGCTC
CTATGGCCCGAGCCCAAATTCAGTCCCTGGAAGTCCGAGAGCTGCGCCCC
GACGCCAATTTCCTCCAGGAGACGAAGCACAAGCCTCCATACGAGTTTCC
CGGGCGCCTTAGATTCTAGAGCAAAAGGTGCAATGTCTCCCCCACCGATT
CCCAAGTTCAGCGCAGTGAATATTGAACTGGTGAGCACGAAGGGCATGGA
CACCGACTCGGCGAGCGAGATGAGCAGTGACGTGGGTGAGTACGAGAAGA
TGAGTGTATCTTCGACAATTGGGAGGGTCGAAGGACAAGGGCTTTTGGCG
AAGAAACTTAAAGGTCTGGAAGTCTTGACGACGAACAGGCCAAGTATTAG
GGGGATGTGGGATATGAAGAATTAAGGTGTTCGATTCTTCCCTGCCAGGC
ACTAGGGAGGTTCTGATAAGACACCGTAACTCAGTACATACCATAGACTG
GTGCTCCTGTCAAAAACCCCTCTGCGATTGCTCATCGCCACTCACATCGC
ATCCTTTATTTCTAGTCTTGATGCAAAATCTGTTATTTTCTTCTTTTTCC
CCGCTCTTCTATTCTATCCTGGGAGGGCTGATTTCTGTCTTTTTTTTATA
TACCTTTGCCATTTTATTTTATTTTATTTTTGTACATTCACGGGCCCGGA
GTTTAATCGGAGGAACAATTCTATCTCATTATGTGTGGTTTGTCATTTCC
TTCTTCCTCTCTAGCAAGATATATGAGCTATACTTGCTGTTTTGTATGAT
GGCGGGAGTTTTTGGCATTGCAGTCTAAATACCTTGTCTCGCCTGCTTAC
CTGCTTGCTTGGTGTTTGAAAAATTCTTCACTTGATAGTCTACGAGGTGA
TGCCGAATGCTGTCATTGGCGAGTGGGTGTGGTGGT

Sequences in the Contig:

SY0AAA1YN18FM1 SY0AAA22YP08FM1 SY0AAA45YM14FM1
SY0AAA49YM07FM1 SY0AAC12YN04FM1 SY0AAC13YE03FM1
SY0AAC21YF12FM1 SY0AAC30YF02FM1 SY0AAC37YF05FM1
SY0AAC37YJ04FM1 SY0AAC45YA10FM1 SY0AAC62YB07FM1
SY0AAC8YH06FM1 SY0AAD19YB15FM1 SY0AAD21YJ08FM1
SY0AAD22YL05FM1 SY0AAD2YN24FM1 SY0AAD40YF07FM1
SY0AAD61YE04FM1