Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4039
Length(NT) : 670
Best Gene Model Blast : Link to GSTUMT00009424001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4039
TTGGCAACCGCCTCACTCCAAGCTCCTTGAAGCATCCCCACAAAACGCCT
CCATCAAAATGGTTCGCAGCAGAAAACGAAGGCATGACGATACAGACGCT
ATCACCGTCAGCAGCCCGTCGAGAAAGGAGTCCAAGAGATCAAAGGGTTG
CCCCGATTACCTCACGTGGGGCATCCCGAAAACGAAGGGTTTGCCTCAAG
ATGAGAAAAGAAGACAGGAACAGCGTCACGAAGCTGATGAGTCTGGCCGT
GCTCAATCCTCCATCTTCAGCAGTGATGTTTGCTCGGCTCGCAAGCCACC
AGCTCTAGATATCTCCCAGAAGTTCGATGCCTTTGGTTCCGCTTTTGCGG
AGCTCATCCTAGCGGCTCCTAACGTTAACATGGAGAAATGTCTTGGTGAC
GAGAAGGCTAACTTCTTTACGGCTGTGCGGATGATGTTCGAGACTGGAGA
TCTGCCGTGGTTAGATGAATACATGAAGAAGGCAAAGGAGGCGCGGGGGA
ATTCAGAGAAGTCGAAGAAAACCCCACCTGCAAATGGAAACAACCCAACA
GGACCTCTCAAAAACGCAGTTCCCAAAGCCTCTGACAGCTCCCCTTCAAC
ATATACCCCGCCATCAACCACAGACCCAGCCTTGCTCTCCCCCTCGTTCT
CCTCCTGGCCCCCTCCTCTC

Sequences in the Contig:

SY0AAB60YE21FM1 SY0AAC22YL17FM1 SY0AAC26YL07FM1
SY0AAD6YJ01FM1