Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4036
Length(NT) : 1309
Best Gene Model Blast : Link to GSTUMT00006962001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Carbohydrate transport and metabolism, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4157 Score: 120 E_value: 5e-07
PFAM Definition: HPC2, Histone promoter control 2 (HPC2). HPC2 is required for cell-cycle regulation of histone transcription. It regulates transcription of the histone genes during the S-phase of the cell cycle by repressing transcription at other cell cycle stages. HPC2 mutants display synthetic interactions with FACT complex which allows RNA Pol II to elongate through nucleosomes..
Pfam Number: pfam08729 Score: 116 E_value: 1e-06

Sequence:
>Contig4036
TTGGCCAACTTTTTTGTACAAAGTTGGTCCCCAAACACCACACACAACTC
ACCACGCTTGTAACTCACACATCTCACCGCTTCCATTTCCTCTCCTTTAC
AGCCTACCGCAAACCCCGCTCCATATTACACTCAGCATTCCAAGCTACAT
CACCATCCCCGCTATCTATCCTCAACCTTCCCCCTCCCATCCCATTGCGG
TACTTTATTAACCACTACTCACTCGCATTGTTTTACTCCTTAAATAAATA
AAAATAATAAAATTTTTACATTTCCACCATCGCAACCATGGCCGACGTCC
GCAAACTCCTACAAGCTGAACGCCGTCAACGCGAAGCCAACAATAAAAAA
AACCCTACCGCTCCTCCTCCTCCTCCCTCCCGCCCGTCCGGGAAAAGACC
ACTCACAGAGAACTCCGGCTTATCCTCAAAACGCACCAAAATGTCCGCCC
CGACAACAGCAAACCTACCCGCAGACTTCTTCTCTGGTGGCCCCGTCAGT
AGTAGTAGTAGCAGCAACGAACGGGTCGAGATACTAGACTCCCGAGTCTC
GAAACCCACCACCACCACCGCTGCCACTGCGGATGACGATCCTATGTCCG
AAGCAGCAACTTCACTACCGCAAGACTTTTTCCAAAAGAATAGTCTGGAA
GACGTAGACGAGGACGAGTGGGCTGCGTTTCAGGCCGAGGTTGCGGCGGA
GTCGCCGCCCGCGGCAACTACCGGTGTACCTCCCGTGGCGACAGTTATTA
CGGCTGCGCCGACACTGAATAGCGCTGGGGGAGAGCAGGAGCAAGGGATA
GATGATGAGGATGACTACGGCAAGGGCGAGGAGGAGGATGCCAAGCAGAA
ACTACTCGACGAGTTTGAGGAGATGGAGAGTCTGGAACAGAGAGTTTTGA
GGCTGAAAGAGCGGAGGGCGGCGCTCAAGAGCAAGCATCCTATCACGGGT
GCACAGATGGAAGTTGTTGAAGTGGAGGTTACGGGGGGAGGGGGGTTGGA
CGATGGTGATGATGATGGCGATGGCGACGGCGATGACGATGAATATGAAG
AAGATGACTTCTTCAGGGCCAGGGGGTCCTAGAGAGAGTGGGTGTGAGAG
AGAAAAATAGAGAAAGGAGGAGACTTTTCTTCTTCGCATTCGTATACAAG
TTCTTAACGTCACGTTTCATTCACTTCACAGCTATTAAACCTCTCTCTAC
AAGCACGCGTGCCATCAGTAAAGGCGGCAGAGAAAAAAGGCTTTGTACAG
TACCAACAGATTGTATACTAGATCGAAACCGAGAACCCAATCCCTCGGTC
ATTCCCCTC

Sequences in the Contig:

SY0AAC22YK12FM1 SY0AAC41YK06FM1 SY0AAC57YG04FM1
SY0AAD33YI07FM1