Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4034
Length(NT) : 805
Best Gene Model Blast : Link to GSTUMT00000431001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4034
AGGTCTACAGCGGCAAAGACCGGCGATCGAGATGACCCGAAAGCTTACCT
GATCGCAGTTGGATCTGTCCATGGTAGGTGCTACGTCTATGACGGCCATG
GAAATAAGGTTGGCGAGCAGGTTGTTGATGTCGCGGGAGGGAAGATCCTT
GGGGTTGAGTGGGTTGCTGGCGATATATGTATTCCACTGAACTCAGGAAC
CTGCGATCCAAATTTATATTCCCACAACCGGTCGCGCCCCGGTTCGGAGC
CTCCCGCCAAAGTACGGGAAGGGCTAAGAGCCAGAACTGGAAGTCGTCTA
GCCACTAAAAATCGAAACCCATCCCGCTCCTCAGAGCCCCAGCCCCCAAT
TCCTGGTGGCAAAGATATTGGGGATTCCTTTTCAAAACTGGGTGCGGGGG
CGGGACTAGAACGTAATGATGTCGAGGAAGTGACCAATCAAGGTTACATG
AGACTTTTCAGCCCCGTGAAAAAGAAGCGACCGCTGAGGGCTTCACCAAC
GAATGAGAAGAAGTCAACTTCAGCAGCGCAGAACTTGGATCCCCAAGAAC
GAGCTCTAAGGATGGAAACCCAGAGAACCTCCATTAGCGCCCCACCCCTA
TGGAGCGGGTCTGGGGAAAAGACCCCACAGCCGTTGGCGCCGGTAATCAG
AAATGACGGTCCTGGCCAGACACCGAACACTGTGACCAAAACTGAGGGGA
AAACAGTGCACAAGCAGGGCCGGGACTGGAGGTATACTAAGACCACACAA
TCGTCCGTCACTGTCAAGCACGTTTCCTCTGGGACTTCTAAGGGACAACC
AGTCA

Sequences in the Contig:

SY0AAC22YJ04FM1 SY0AAC28YL12FM1 SY0AAC37YH21FM1