Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4033
Length(NT) : 1253
Best Gene Model Blast : Link to GSTUMT00003074001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein MGG_02949
Accession: ref|XP_366873.1| Score: 886 E_value: 3e-93
KEGG Definition: hypothetical protein
Accession: mgr:MGCH7_ch7g722 Score: 886 E_value: 1e-93
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0980 Score: 406 E_value: 3e-40
PFAM Definition: Myosin_tail_1, Myosin tail. The myosin molecule is a multi-subunit complex made up of two heavy chains and four light chains it is a fundamental contractile protein found in all eukaryote cell types. This family consists of the coiled-coil myosin heavy chain tail region. The coiled-coil is composed of the tail from two molecules of myosin. These can then assemble into the macromolecular thick filament. The coiled-coil region provides the structural backbone the thick filament..
Pfam Number: pfam01576 Score: 220 E_value: 1e-18
Swissprot: Q9P6L5|SLA2_SCHPO
Gene Ontology:
GO:0030479 = Cellular component: actin cortical patch
GO:0051285 = Cellular component: cell cortex of cell tip
GO:0032153 = Cellular component: cell division site
GO:0005515 = Molecular function: protein binding
GO:0042815 = Biological process: bipolar cell growth
GO:0030866 = Biological process: cortical actin cytoskeleton organization and biogenesis
GO:0006897 = Biological process: endocytosis
GO:0030950 = Biological process: establishment and/or maintenance of actin cytoskeleton polarity
GO:0007163 = Biological process: establishment and/or maintenance of cell polarity
GO:0031505 = Biological process: fungal-type cell wall organization and biogenesis
GO:0008104 = Biological process: protein localization

Sequence:
>Contig4033
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCCCCAATCTACTCAGCGAG
GAAGATGCACCCCCGGCACTCCCACGTAGACCGGCGAACGAGATGCCTCC
ACCTCCCGAACCCATTCCTAGCCCACCCGCAATTTCCCAGCCCGAACCCG
AGCCGATTTCCGACTTCTGGTCTCAAGAGCAACTGCAGCAACAACGGGCA
TACGAGGAGGAGCAACGCCGGCTACAGGAGCAGAGGGAAGCGGAATTGCG
GCAGCAGGAGATGCTTGCATTGCAGAACCAGAGGGCCTATGAAGAAATGC
AGAGACAGCAACAAGAGCAACAGAGGCTAGCGCACGAACAGCTTCTTAGG
GATCAGATGGCACGGCAAGCTCAGGGTCAAGCTGCTGAATTGGAACGTCA
ATTGTTGGAGTACCAGGGTCAATTGGCCAACAATGTATTGCTGCTGGAGT
CGTACGACCAGAAGGTGAAAGCTCTTGAGACAGAGTTGATGAACCTCAAC
TTGAACTCTCAACAGCAGCAGCAGTCTAAAGATGACCTCATCAAGTCGCT
GCAGGACCAGGTTGCTATGTGGAAAAGCAAGTACGAGGCTTTAGCCAAAT
TGTACTCCCAGCTTCGACACGAGCATCTTGAACTATTGGGCAGGTATAAA
CAGATGCAACTCAAGGCCAATTCTGCGCAAGAGGCTGTTGAGAGGCGAGA
AAAGTTGGAGCGCGAAATGAAGTCCAAGAATTTGGAGCTCGCCGACATGA
TCCGCGAGAGAGATCGTGCTTTGTACGATTTGGACCGAGTCAAGGGGGCT
CAAAAAGAGGAGGTGGAAAAAGTGAAACGAGAACTCCGATTTGCTCAGGA
AAAGGCGGACAATAATGAGCGATCTAGGGGTTCCGAGCTCTCTGCACTCT
TGACACGGCATAATCGTGAAGTGGCGGACTTGGAGGATATACTGCGTGGG
AAGCAGCGCATGATTGATGAGCTTTCCTCTCGGAGCGATGACAAACATAA
TGATATGGAACAATTGCTTAGGGCCAAGGAGGAGGAGCTTGAAATATTCA
AGGCCGGCATGGACCAGACTCTGTTGGAACTCAGCGAGATGCGCCACAAC
AACACTGAAACTGATCACGTGCTTGAGGCTCAGATTGACGAGCTGCTCCT
CGATCAGCTCAAGAAGCTGACAGAGATTATTGACTCTGTGCTTCAGAGTG
GTGTTCAGCGTATCGACGATGCCCTCTACGAGCTAGAATCCCCTATGAAT
GCA

Sequences in the Contig:

SY0AAA62YM11FM1 SY0AAC22YI24FM1 SY0AAD49YJ16FM1