Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4031
Length(NT) : 703
Best Gene Model Blast : Link to GSTUMT00009180001 E-value : 1e-146
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_15247
Accession: ref|XP_001805404.1| Score: 139 E_value: 5e-07
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Nuclear structure].
Kog Number: KOG2992 Score: 219 E_value: 7e-19
PFAM Definition: DMP1, Dentin matrix protein 1 (DMP1). This family consists of several mammalian dentin matrix protein 1 (DMP1) sequences. The dentin matrix acidic phosphoprotein 1 (DMP1) gene has been mapped to human chromosome 4q21. DMP1 is a bone and teeth specific protein initially identified from mineralised dentin. DMP1 is primarily localised in the nuclear compartment of undifferentiated osteoblasts. In the nucleus, DMP1 acts as a transcriptional component for activation of osteoblast-specific genes like osteocalcin. During the early phase of osteoblast maturation, Ca(2+) surges into the nucleus from the cytoplasm, triggering the phosphorylation of DMP1 by a nuclear isoform of casein kinase II. This phosphorylated DMP1 is then exported out into the extracellular matrix, where it regulates nucleation of hydroxyapatite. DMP1 is a unique molecule that initiates osteoblast differentiation by transcription in the nucleus and orchestrates mineralised matrix formation extracellularly, at later stages of osteoblast maturation. The DMP1 gene has been found to be ectopically expressed in lung cancer although the reason for this is unknown..
Pfam Number: pfam07263 Score: 127 E_value: 3e-08

Sequence:
>Contig4031
TTGGCGAAAGGAGGCTGTCGCAAAAGACTCTTCTGATTCCGAGTCCAATG
CATCTTGTAGCGATGGTGATGGTGGTGATAGTGATAGCGATTCTGACGGA
GAAGCGCCAAAGGCTAAAACTGCGTCGGAGACCACATCTATTTCCAGTTC
CGGTAGCGATTCCGATTCTTCCTCTGACTCTAGCTCTGATGAAGAGGAAG
CACCAGTTGCCAAGAAGGCAGCTCCTGTCAAGGCTGTCAATGGCACCAAG
AAGACTGTGGGAGTACGAATTTTCATGATATTAATATGATAGCATGCAAC
TAACGTAAGATAGGTGGCTGAATCTTCGTGCGAATCCGATAGCGACTCTG
ACTCGTCCTCCGATTCCGATGCCCGAGTCAAGTCTACCGGGAAGGCCGTT
TCTGATTCAGAATCATCCGACTCCTCCGATTCCGAGTCAGATGCTAAGGT
CAAGTCTGCCAAGAAGGCTAGCGCTGATTCAGATTCATCATCCGACTCAT
CTGATTCCGAATCCGATTCGGATTCTTCGGATTCTTCGGATTCGGGTTCG
GGTCGGGCGGGGTCCGGCTCCAAGAAGCGCAAAGCTGCCACCGAGGCCGA
GCCCACTCCAAAGAAGGTCAAAACTGTATCCTCCGCTCAGGAGGGAGCCA
AAAATCTTTTTGTTGGATCACTGTCATGGAACGTTGATGAAGGTTGGTTG
AGA

Sequences in the Contig:

SY0AAC22YH18FM1 SY0AAD59YI07FM1