Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4030
Length(NT) : 555
Best Gene Model Blast : Link to GSTUMT00006065001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: amino acid transporter, putative
Accession: ref|XP_001270048.1| Score: 148 E_value: 3e-08
KEGG Definition: hypothetical protein
Accession: ani:AN6519.2 Score: 134 E_value: 5e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4030
TTGGCAAACACTCAACCGTCCCTCTCCGTCTCGCCTTTTTTTCTCTCCTT
CGACTTCTTATCTGCCACCGTACCAATCCTCTCGTTTATGCAGTGGTACG
GAGGTGATCCGGCTCATCATCCATCATCTACACACAAAGCCAAGCTCTTT
GAAGTGGTCGATCCTCAAACCTAATATTTTCCATTCTTCCTGGGCCCTGC
TGCAATGACCCACGTAGGTTACGAACCGACTCCGACTAGGGATTCACTTG
AACTGGACTCGCTGGTCTCATCGTCAGCTTCTGCGTCACCGCGTTCCTCG
ACATCCTCCCGCTCTGGAATCTCGTCCTCCCGTCGACTGTCGCTTGCTTC
TGGCGATGAGGATGTTGAACCTGGTCGGCCACGTGCTTACCGCTCCTATT
CCGTGTCCTCTGCTTTTGACTTCAATACCCATTTAGTGCCCCTTACCTCA
TCGGCGGAAACCCGATATCAGCAACTAGGCGTGACCAACACTCCTGGCTC
GAATCCTGTGGGTACATTAGAGAAGCAAAAAACTCTCACCTACCTCAACG
GATTA

Sequences in the Contig:

SY0AAB50YJ09FM1 SY0AAC22YH10FM1