Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig403
Length(NT) : 1104
Best Gene Model Blast : Link to GSTUMT00001314001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein An03g06400
Accession: ref|XP_001390515.1| Score: 427 E_value: 4e-40
KEGG Definition: hypothetical protein
Accession: ang:An03g06400 Score: 427 E_value: 2e-40
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig403
TTGGCTTTGATTCTCCGGGTGGGCTGCTGTCCGATCCCGCTAGGCGCCAT
GATCCCATGGTCCATGCAATCCGTAGATCCGACTCTAGAGATCTCTCCAC
AAAACATCCCGCAAGGCACTCTACCCGGACTTCATACATCTCCCTCCTTC
GTTGACCCATCGCTAGATGATGCTAGCCCCCACCACCCCAATTCCACACC
CTTCGTCACTGATGCGGACGGGATGCAAATTAATCTTGTTTCCACCGTAA
ACTCCGGTTTCGGCTCAGGAGATCAATGGGCACAAGCTTTGTTTGCCGAA
CCTTCCTGGCTGATCGGACAGGGCTTTGATTTCGGAGCATTAAACGCCTC
GATTATTCCTGGCTTTTCCGATGTCAATGCTAACATCTATGTGGATGACG
ATACTGTCTCATCTGTTTTACCTCCACCAACTATAACAGCTTCTTTGCAG
GAAAATCAGAGTCAAATTGCCGTCGAGTACAAGCCCCCAAGGACGAACGT
AGCAAAATTGTGGTTTACGTCTATGGGTCCATCGGAAGAGAATGATGAAC
CGTCGAGGCCCGGGAGCGCCTCGTTGATGTCTCCCGATCGTGAAATGGTG
GACGCCGGAGATGAGAATTCGGGTGTTTTTGACGAGCAATATCGGCGGAG
ACTGTCGAATCAGATGAAGCCGAAATGGGCGGAGGAGCCACTCCCCTCTG
TAGACTTTCTGAACCTCTGCGTGCAAATGTATTTTACAAAGTGTAGTATT
CTTCTGCCGATTTTGCACCGCGCCACCTTCAAGCCGACACCCGAGAATTC
TTTTTTGCTGCTCACGATATGTACTCTTGGGAGTTTATTTATTGGGTCTG
CGAGTGCACGGAAGCAGGGTGAAAGGATCTTTGAAAGGGTTAATAAGGTT
ATTCTTGCATCATGGGAAAAAAGGCTCGTACGAGGGGCTGGGGAAGAATT
GGCCTTGATACAATCTTCACTTATCGGGCAGACATACGGTCTGCTCTCAG
GATCCCCCAGCCATCTCGCGATTATCAGTGCTTTCCACGGAACCGTTATC
TCGGTACGTTTTTTTCTTGCAGCGATCGTTGATTTAATAGCCTTTACGCT
TACC

Sequences in the Contig:

SY0AAA22YO24FM1 SY0AAC18YH24FM1 SY0AAC4YN19FM1
SY0AAC50YL08FM1 SY0AAC61YN14FM1 SY0AAD11YF01FM1
SY0AAD31YF23FM1 SY0AAD36YE05FM1