Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4029
Length(NT) : 1007
Best Gene Model Blast : Link to GSTUMT00011398001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: tetratricopeptide repeat protein
Accession: ref|XP_001262068.1| Score: 438 E_value: 2e-41
KEGG Definition: TPR repeat-containing protein
Accession: aor:AO090005000623 Score: 423 E_value: 5e-40
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q99144|PEX5_YARLI
Gene Ontology:
GO:0005778 = Cellular component: peroxisomal membrane

Sequence:
>Contig4029
TTGGCACACCTCAGTCCTCCTCGGTAAAAAAAATAAACGCGCTCCACCAA
CTAGTGTAGACCCTCTTCCTCGCTTCCCTATTCAACTCCATTCTTTTTCC
CTGCAGCTCCCTTCTCTCCACTATTCCAGCAAAAAGTAGTTGAACCTCAA
AACCCCTCCCCCTCCTTGCAAATCGACTGGCTCACTGGTTTGACCGGGAA
AACAGTCAATAGTGATGTCCTTCCTCGGCGGTGCTGAGTGTTCAACTGGA
CGCAATCCTCTTGCTCAGTTCACCAAACATGTTAGCAAGGACAAGAGTCT
CGAGAGGGATCGCTTAGGTAGCCTCCCTGTGGGGCCCGAACTTGGTGGTT
TGCGAACGGCGGGAGGTGAAATGGCGGGTGCGGACAAGCAGATGATGGAT
GAATTTTATAGCCAACAATCTGGAGCATCCCCCTTCGCTTTCGAATCAAT
GCGGCGAGAGCTCTCGGATCTGCAGCATGGACCAGCGCCCATGGCAGGCC
AACCCTGGGCTTCCGAATTTGGGACCCAGCAGGCCATGAATCCTCAGGAG
CAAGCCATGATGGAGGCTGCGTTTGTCGCCAGAAACAAATCTAGCGAATT
CAGCACAGCAGAATTCGCTCGCTTCCAGAATTCCCCTTCCTCTGGTGATA
TCCAGATGGCATTACCAGCTCCAACTCAAGCAGCCTCGACTCCCTATTAC
CAACAATTTCGTGGATACAACAATTTCAACCAAGGTTTACCGTTCCAAGT
CCATCAGCCGATGATACAGCAGTTACAGATGCAGAACCAACAACAAGACC
CGAAGGGCAAGGGGAAGCAGGTTGTAGAGCTATCGGATGAAAACTGGGAA
TCCCAGTTCAAAGAAATGGAGGCCATGAACAAGACTTTAGATGCGGACGA
TCAGGCAAATAAGGATATCGAGGCCGAGCTAAACTCTCAACCAGAAACCA
TGTATGGTGATTTCCAGTCGGTATGGGAAGGGATTCAAGCCGAGACTGGT
GGCGCTG

Sequences in the Contig:

SY0AAA46YH14FM1 SY0AAA52YK16FM1 SY0AAB55YH21FM1
SY0AAC22YF23FM1 SY0AAD42YK10FM1 SY0AAD59YK05FM1