Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4028
Length(NT) : 2034
Best Gene Model Blast : Link to GSTUMT00006756001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein CIMG_01146
Accession: ref|XP_001247375.1| Score: 314 E_value: 1e-26
KEGG Definition: hypothetical protein
Accession: ang:An11g01990 Score: 313 E_value: 8e-27
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4028
TTGGAGGAGACTTTCAACCGTTAATTTGTTGACTTGGGTTGAAGGCTTCG
ACCGCCTAGTATTTCTGTAATAGGGTCTCGCAATTAGCAGACGACGATTA
ACGACAACTTCAGCTGCTCCCCAGTTGAGATACGACCAATAATATCAACG
GCCATTTGACGAGCACATCCAACTGAAACTTGTACCGACGAGACGGTAAA
GCCTCCACCCTCCGAACCCTGAAGCACGATACTAGTACTTCACCTGTCAG
CATTAACATAATACAATATTTCAGCGAAACCTCAGTAAACATGATGCAGC
CTGGAGCAAAACGTGATCGTATGCCGTTCTTGGCGACCGAATCTTTGCAA
TCTGCGTTGTTTCAATCACCGGAGCAAGGCTCTATTGCTCCGTGGCTTGA
AGATGCCTCTTCTGATAGTATTCCCTCCACACCCCCCCCTCAGTTGCTGT
CGCCTCAACCTCTCACCCCAAAGCCAACGAGATTTGTTTCACCCCCCCGC
ACTCCGCTACCCAAACTTTTCACCAACCTCACTCCGCGAGCCATTCGCCA
ATGGGAGGCAACTGAGGGAGCCGGGAATACTGCTGCATCCATCGGCCGTC
CAAATTCTGCTTGCTCCAACTATTCTTCATCTTCGGATTCATCGCTTGAT
AGCTTGACTACCTTTACCACAGCGGGAGGAAGTTGCACTAGTCCTGAAAC
TGAGGCTTCCTTCTTCGCCGATGAGCCGGAGGGAGAGACTACCCACCTTA
AGCCTACCGATGCCGTAAGATGGAGTAGCAAGATACAAGATGGAACCGGA
GAGAAGGACAGTGCAAACCAGATCCGTGTTCGGAAAACCAAATGGACCGA
GGAGATGGACAACCATTTGTGGAGGACATATATAATATACCAACAGGATC
CTAAGATAACGCCATTTTATGTCTTGCCGGGGCAAGTCCCACCTTTGGGA
GTATGTTGTAAAGTCGCCAGGGAGACAAAAAGGAGTTGGAAAGAGGCCAA
GATGGGTGATGGATGGAAAGGTGTACCGAGCACCCCGAGGCCCAAGAGAA
AATCAAGGGTTTCGGGTTATAAGACGGAGAGTAATGATACTGCGGCCGGG
AATAGGGGAGACATCTTGCGAAAGACTTCGCCGTATTCGTGGCCTGCATC
CGAGGCCTCGACTCGTCGTCGTTTGAGAGAGTTGTGTAGAGGCAGCTATG
GTCCTTCGGTAAATCCTCACCGAGAGTATCGGCAACAGCGTCGAACAGCG
TCCACACCGAGACTCCTTCCCCCTCGGTCATCAACGGTATCACCTTCCCC
ACTCAATTCAGCCAAATCAGATAGAATCGGGTCTCGGGATTCCTTTTTGT
TCTCGACAAGGAGTATAGCACTTTCTTTGACAACTAGTACGGCGTCCACC
ATGAATTCGAATGGGCTTTTGGCTGCTATTGCCTCTGGTTATGATGTTGA
ACCCGGGATGGCCGCGGGCTTCGGGAGTGGCAACTTTGATTTCGGTAGAG
TTCCAGAAAGTGTTTCTGGCGTAAATAGGTGTAGTAGCAGTGTTTTCAGA
GGAGGCGAGGAGTCTCAATTGCAACATACCGGAGACGAGACGGAACAGGG
TAGCCGGGTCAGACAAGAGACCAGTAATGGTCCTTCTAGCTCGTCGAGTA
GCAGGCCCTCGAGGTCAGGGGGTTTGTTGCCGCCGCTGGAGCTGAAGTCG
TCTTCCTCCTCATATGGCACCTGGCCAAGACGCCTCAAGCGTCAGGAGAT
ACTCCCCGACTTCAGTGAGGACGCGGTTGTTTTCCCTCCGCCCCGCAGAG
CTCGCAGGGGAACAATTGGTGACCTCTTTGGTAATCCCATCTCCTCTCCC
CCAACCACTACCCCGACATCATCAAATGCAGGCACAATGTCTACGGCAAC
AAACACAACAGCTCGCAGCGCACGTAGTCGAGGGTTCACTATCGGAGCCA
GTTTCGGTAGTGGTCTGACCAGCCGGAGAAGGTATCGGCCATCAGCACCT
CTGCTGACAGTCACTGGCCCGGTGTCTTATGACT

Sequences in the Contig:

SY0AAA35YN22FM1 SY0AAA38YH19FM1 SY0AAA45YF13FM1
SY0AAB23YH18FM1 SY0AAB54YP18FM1 SY0AAC22YE18FM1
SY0AAC55YB22FM2 SY0AAD62YC02FM1