Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4026
Length(NT) : 847
Best Gene Model Blast : Link to GSTUMT00002238001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SNOG_00083
Accession: ref|XP_001790779.1| Score: 584 E_value: 2e-58
KEGG Definition: hypothetical protein
Accession: fgr:FG03272.1 Score: 566 E_value: 1e-56
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0254 Score: 275 E_value: 3e-25
PFAM Definition: Sugar_tr, Sugar (and other) transporter..
Pfam Number: pfam00083 Score: 313 E_value: 1e-29
Swissprot: P07921|LACP_KLULA

Sequence:
>Contig4026
TTGGCGAAACAATGGGAACTGCTCTGATACGGCTGCAGACATGGGTTTCT
TGCTGTGGGATGGTGTGCTGTGGGTTTCCCCACTGCGGTCCGCCGAACGG
CAGCCAGAACGGTAAAACGTGGTAGAACTAAGGCGGGGGATTCCACTTTT
CCCATGGGTTCGGTAGTTTATAAGGAGAGGGCTTCCCCACAGACTTTCTC
TCCGCTGTTCGACTTCCTTTCTTTTTACTCTCCATACCCATCGTGAGGGA
GACAATCAATTGCCCCACATGTCGGAGGTAAAAACTACCCCCAACGTCTC
CACTTACCAGTCTCGCCAAGGCAAGAGGGAGGTTGTTGCAAATGTATCAC
TCGCCGATGCTTTGGCCCAGGCCAAACCCAATCCATGGACTACGAGGATG
TTCAAACTTTACTTCTTCCTGCTTATTGCTTTCCTGAATTCGTGTATCAA
TGGATACGATGGTTCATTGATGGGAGGTATCAATGCTATGAAGACATATC
AAATGTATTTCAATATGAAGGATGTTGGAAGCAGCACTGGATTGGTATTC
TCCATCTATACAATCGGTAACATCGTTGGATCATTTTTCTGCGGTCCATT
CACAGATTGGTGGGGCCGGAGATGGGGTATGTTCATCGGTGCTAGTATCA
TTATTCTCGGGACGTGTATCCAGGCTCCTTCCACCGATAAGGCCATGTTC
ATTGGAGGCCGTTTTATACTCGGATTTGGTGTTGCTACTTGCGCTACTGC
CGGTCCTTCATATGTTGCCGAGATGGCCCATCCCGCTTGGCGGGGAACCA
TTACCGGCATGTACAACACCTTTTGGTTTATTGGTGGTGTTCCAGCA

Sequences in the Contig:

SY0AAC21YB07FM1 SY0AAC22YD03FM1 SY0AAC47YF15FM1