Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4025
Length(NT) : 1122
Best Gene Model Blast : Link to GSTUMT00006611001 E-value : 0.0
Numbers of ESTs : 298

Blast Results:

Nr Definition: hypothetical protein CC1G_05615
Accession: gb|EAU83711.1| Score: 628 E_value: 2e-63
KEGG Definition: hypothetical protein
Accession: ncr:NCU07352.1 Score: 409 E_value: 3e-38
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2133 Score: 108 E_value: 9e-06
PFAM Definition: No Hit Found

Sequence:
>Contig4025
TTGGCCAACTTTTTTGTTGGATTTGGGATTTCCTCTTTTCATAAAAAACC
TTTACCCCACACCACTTCACGATATACTGCAGCAAGCAGAGATGCAGTCC
ATAGATCCAAAATCCCTCTCAACCCTCCAAGCCCGCGTCGCCTACTTGAA
ATCCTTCATAGGCTTCACCCAAGCCGATGCCGCGGCCCTCCACGGTGCGA
GACCCGTCGTGGAAGCGCTCATCCCCACAATCGTCGATGCGGTCTACAAG
AAACTCCTGAGCTTCGACATCACCGCGAAAGCATTCGTGCCCAGACAGAC
CGGCTACGATGGCGTCGCGCCGACAAAGGTGGAGGAATTGAATCTGGAGC
ACCCGATGGTCAAGTTCCGGATGGGCTTTCTGAAGGGATATTTGAAGAAG
TTGGTTGTGGTCGATTACGACGATTTGGGGACTTGGGAGTACTTTGATAA
AGTCGGGATTATGCACACTGGTGTTGCGGGGTTCGCTCACAGGGCAAAGA
AACCCGGCCTCCGCGTCGAGTACATCCACATGGGGCTTCTCCTCGGCTAC
GTCGTCGACCTGGTGATTGCGGCGGTCCTGGCTCGCCCGGACCTGGATAA
CGAGACGAGGAGCGCCGTTTTGACGGCGTTGAATAAAGTGATTTGGATAC
AGAATGACCTGTTTGCGAGACATTACGTTGTGGATCTGGATACCCCTAAT
TCAATCGCTTTTCCGAAGAACGGGCTGTTGCATGGGTGGGTGGGGCAGAT
TGTGGTCGGAGTCGTGATCACGGTTGGTGTGTTGGGGGTCCAGACAATCC
TTCGGGGGTCGTCGTAAAGTATAAGCTAATGTCTTGAGGTTGACGATGTT
AATGAGGATACAGTGTTTATTAAATTGTAAGATTTCCTATAGTATTTCCC
TTACGGCGCATCATGTTTTGCCTCGTACTGTTGTACTCTTGTTCTCGGAA
TCTCTCTACTCTTGGGTATTAGCGGGCTTGTACAGGATGTTGGATTGAGA
TGATTCTCGGAAGAGGATATACTATATCACACCTCGAACCTGTTTTCAAT
AGTCACCTAGAGCTTGCGCTTATCGCGCAATATATTTTCACACAAATTCC
CACATCTCAATCGATTCACGAC

Sequences in the Contig:

SY0AAA12YB21FM1 SY0AAA12YI06FM1 SY0AAA14YI03FM1
SY0AAA16YK12FM1 SY0AAA1YH05FM1 SY0AAA22YG17FM1
SY0AAA22YG17RM1 SY0AAA23YN14FM1 SY0AAA24YC19FM2
SY0AAA27YF20FM1 SY0AAA32YJ07FM1 SY0AAA39YH16FM1
SY0AAA41YI22FM1 SY0AAA41YO08FM1 SY0AAA48YO18FM1
SY0AAA53YM19FM1 SY0AAA61YM20FM1 SY0AAA6YH22FM1
SY0AAB11YD10FM1 SY0AAB12YA14FM1 SY0AAB13YL12FM1
SY0AAB14YD02FM1 SY0AAB14YI10FM1 SY0AAB17YD06FM1
SY0AAB19YP08FM1 SY0AAB1YK16FM1 SY0AAB27YK15FM1
SY0AAB2YC05FM1 SY0AAB2YP23FM1 SY0AAB3YA04FM1
SY0AAB40YI16FM1 SY0AAB42YH04FM1 SY0AAB46YG04FM1
SY0AAB49YO14FM1 SY0AAB51YI03FM1 SY0AAB51YN08FM1
SY0AAB52YJ08FM1 SY0AAB7YA06FM1 SY0AAB7YL09FM1
SY0AAB8YK08FM1 SY0AAC10YG10FM1 SY0AAC11YE05FM1
SY0AAC11YJ14FM1 SY0AAC11YL02FM1 SY0AAC13YJ01FM1
SY0AAC14YI09FM1 SY0AAC14YN04FM1 SY0AAC15YH13FM1
SY0AAC16YP18FM1 SY0AAC17YB02FM1 SY0AAC17YD01FM1
SY0AAC17YH05FM1 SY0AAC17YO06FM1 SY0AAC18YK24FM1
SY0AAC19YE17FM1 SY0AAC19YG18RM1 SY0AAC22YA10FM1
SY0AAC22YA16FM1 SY0AAC22YC12FM1 SY0AAC22YE11FM1
SY0AAC23YL20FM1 SY0AAC24YJ04FM1 SY0AAC25YC13FM1
SY0AAC25YC13RM1 SY0AAC26YC23FM1 SY0AAC26YE02FM1
SY0AAC26YE02RM1 SY0AAC26YE17FM1 SY0AAC26YH18FM1
SY0AAC26YH18RM1 SY0AAC26YL14FM1 SY0AAC26YP21FM1
SY0AAC27YA12FM1 SY0AAC27YH11FM1 SY0AAC27YM06FM1
SY0AAC28YJ06FM1 SY0AAC28YP24FM1 SY0AAC29YD02FM1
SY0AAC29YH04FM1 SY0AAC29YI18FM1 SY0AAC2YK11FM1
SY0AAC30YO21FM1 SY0AAC31YK01FM1 SY0AAC31YK01RM1
SY0AAC31YK09FM1 SY0AAC34YA18FM1 SY0AAC34YG11FM1
SY0AAC34YN14FM1 SY0AAC35YE20FM1 SY0AAC35YJ11FM1
SY0AAC36YP03FM1 SY0AAC37YD15FM1 SY0AAC37YN01FM1
SY0AAC38YC12FM1 SY0AAC38YM19FM1 SY0AAC38YM22FM1
SY0AAC38YO08FM1 SY0AAC39YA03FM1 SY0AAC39YK19FM1
SY0AAC3YN05FM1 SY0AAC3YN09FM1 SY0AAC40YA24FM1
SY0AAC40YC16FM1 SY0AAC40YF23FM1 SY0AAC40YK23FM1
SY0AAC41YE13FM1 SY0AAC41YG21FM1 SY0AAC41YJ17FM1
SY0AAC42YF24FM1 SY0AAC42YO20FM1 SY0AAC43YE05FM1
SY0AAC43YH13FM1 SY0AAC43YO01FM1 SY0AAC43YO07FM1
SY0AAC44YN17FM1 SY0AAC45YA02FM1 SY0AAC45YB03FM1
SY0AAC45YJ07FM1 SY0AAC45YL24FM1 SY0AAC45YP17FM1
SY0AAC46YG02FM1 SY0AAC46YL01FM1 SY0AAC47YI04FM1
SY0AAC47YM17FM1 SY0AAC48YA13FM1 SY0AAC48YD08FM1
SY0AAC48YE09FM1 SY0AAC48YF04FM1 SY0AAC48YF12FM1
SY0AAC49YE08FM1 SY0AAC50YK03FM1 SY0AAC50YN18FM1
SY0AAC51YM21FM1 SY0AAC51YO20FM1 SY0AAC52YA18FM1
SY0AAC52YK20FM1 SY0AAC53YB12FM1 SY0AAC53YP11FM1
SY0AAC54YH23FM1 SY0AAC56YD21FM1 SY0AAC56YD24FM1
SY0AAC56YI01FM1 SY0AAC56YJ23FM1 SY0AAC56YO13FM1
SY0AAC57YL14FM1 SY0AAC58YL14FM1 SY0AAC58YP07FM1
SY0AAC59YD06FM1 SY0AAC59YJ18FM1 SY0AAC59YL20FM1
SY0AAC5YF11FM1 SY0AAC60YA17FM1 SY0AAC60YC04FM1
SY0AAC61YC03FM1 SY0AAC62YC03FM1 SY0AAC6YE15FM1
SY0AAC6YH14FM1 SY0AAC8YO16FM1 SY0AAC8YP16FM1
SY0AAC9YK01FM1 SY0AAC9YM07FM1 SY0AAC9YO19FM1
SY0AAD10YF02FM1 SY0AAD10YN13FM1 SY0AAD11YC12FM1
SY0AAD11YG01FM1 SY0AAD12YP14FM1 SY0AAD13YE22FM1
SY0AAD13YM08FM1 SY0AAD13YN08FM1 SY0AAD14YP21FM1
SY0AAD16YE23FM1 SY0AAD17YM12FM1 SY0AAD18YJ17FM1
SY0AAD18YO14FM1 SY0AAD1YE13FM1 SY0AAD1YF19FM1
SY0AAD20YH24FM1 SY0AAD21YE11FM1 SY0AAD21YL20FM1
SY0AAD23YA14FM1 SY0AAD23YJ10FM1 SY0AAD23YK02FM1
SY0AAD24YC18FM1 SY0AAD24YF22FM1 SY0AAD24YN06FM1
SY0AAD25YE17FM1 SY0AAD25YN12FM1 SY0AAD26YA04FM1
SY0AAD26YA06FM1 SY0AAD26YD08FM1 SY0AAD26YD10FM1
SY0AAD26YD14FM1 SY0AAD26YG19FM1 SY0AAD26YP09FM1
SY0AAD27YC21FM1 SY0AAD27YK22FM1 SY0AAD28YJ19FM1
SY0AAD29YF20FM1 SY0AAD29YG01FM1 SY0AAD29YL23FM1
SY0AAD29YP14FM1 SY0AAD29YP15FM1 SY0AAD30YK20FM1
SY0AAD31YA15FM1 SY0AAD31YK12FM1 SY0AAD31YM13FM1
SY0AAD31YN18FM1 SY0AAD31YN21FM1 SY0AAD32YB04FM1
SY0AAD32YD11FM1 SY0AAD32YF03FM1 SY0AAD32YN22FM1
SY0AAD33YI11FM1 SY0AAD33YI16FM1 SY0AAD33YI24FM1
SY0AAD33YM07FM1 SY0AAD33YN13FM1 SY0AAD34YI04FM1
SY0AAD34YL09FM1 SY0AAD34YM03FM1 SY0AAD35YJ20FM1
SY0AAD36YH15FM1 SY0AAD36YI24FM1 SY0AAD36YP07FM1
SY0AAD38YB11FM1 SY0AAD3YH08FM1 SY0AAD3YI05FM1
SY0AAD3YK22FM1 SY0AAD3YN02FM1 SY0AAD40YC09FM1
SY0AAD40YL14FM1 SY0AAD41YF19FM1 SY0AAD42YB05FM1
SY0AAD42YH05FM1 SY0AAD42YM19FM1 SY0AAD44YE20FM1
SY0AAD44YL23FM1 SY0AAD45YB09FM1 SY0AAD45YC03FM1
SY0AAD45YD14FM1 SY0AAD45YF20FM1 SY0AAD46YA24FM1
SY0AAD46YC06FM1 SY0AAD46YG14FM1 SY0AAD46YI24FM1
SY0AAD46YL05FM1 SY0AAD46YP01FM1 SY0AAD47YD03FM1
SY0AAD47YP22FM1 SY0AAD48YA01FM1 SY0AAD48YB05FM1
SY0AAD48YH01FM1 SY0AAD48YN14FM1 SY0AAD49YD14FM1
SY0AAD49YG10FM1 SY0AAD49YN07FM1 SY0AAD4YA13FM1
SY0AAD4YG08FM1 SY0AAD4YL12FM1 SY0AAD50YH24FM1
SY0AAD51YB24FM1 SY0AAD51YK17FM1 SY0AAD51YO19FM1
SY0AAD51YP06FM1 SY0AAD51YP08FM1 SY0AAD52YJ01FM1
SY0AAD53YG24FM1 SY0AAD55YI10FM1 SY0AAD55YJ15FM1
SY0AAD56YG08FM1 SY0AAD57YB23FM1 SY0AAD57YB24FM1
SY0AAD59YD16FM1 SY0AAD59YG06FM1 SY0AAD5YB04FM1
SY0AAD5YD08FM1 SY0AAD5YF02FM1 SY0AAD5YI05FM1
SY0AAD5YI20FM1 SY0AAD5YP15FM1 SY0AAD60YP03FM1
SY0AAD61YB05FM1 SY0AAD61YI24FM1 SY0AAD61YN03FM1
SY0AAD62YB21FM1 SY0AAD62YD19FM1 SY0AAD62YD21FM1
SY0AAD63YG07FM1 SY0AAD63YK04FM1 SY0AAD6YH18FM1
SY0AAD6YO17FM1 SY0AAD6YP19FM1 SY0AAD7YC06FM1
SY0AAD7YM08FM1 SY0AAD7YP10FM1 SY0AAD9YE16FM1
SY0AAD9YL05FM1