Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4023
Length(NT) : 456
Best Gene Model Blast : Link to GSTUMT00002176001 E-value : 1e-132
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4023
TTTCCAACAAATGGCATTCCAGGGTTCCTGGGTGGCTGGGACCCTGCGGA
CCCTTTTTTTGGTGGCATAGGTAGTGCACAAAATATCGAAGCGTTGGGGG
CTATGAATGGACAACCTATCGGTATCGATGCTGCAAACGTGCTTAACCAA
CAGCAGCAACAGAATGAACTATTGAATATCCTCCAGGACGAATCCTTACA
GCGGTTTGATGTAACGAGGCATTGGGTTCCCGATTACGAGAGTCCGCAAT
TTTATTGACCTCTTGGTCGGGGTTGGCGGTGTTTCTGCTTTTGATCTCTG
CAGTTTTCATCGATACCTTCCATTCTCCTTGTTTCTTTCTCGAACGGGTT
GGTGGAATGGATGGTGAAATTGCAATATGGCTTATGGTTTTCCTTAATTC
TCTGGTTATTAGGCTGTCAGTTTCTAAAAAATCATCAAATTTATTGAAAC
GAAACG

Sequences in the Contig:

SY0AAB57YE16FM1 SY0AAC22YB18RM1 SY0AAC42YL03FM1