Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4022
Length(NT) : 643
Best Gene Model Blast : Link to GSTUMT00005281001 E-value : 1e-150
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4022
TTGGATCCACTGCACTTCCTCACAAAAAACAAATCATACTTCCAGCAATC
CTATATCCCGGAGGTTTCCAACTTCAAGCTTCCTTTGCCCGAACGCCTTC
CAGCACCAACAGTCCACACCGATCATACATGTTGTGGCCATACTGGCGTT
TCCTGAGCCGTCAAAAAATCGGCCAGCACATTTATCTATGACGGAACCTC
AAACTAACTGGAAGCGCCTTGATAGGATCACCATTTTAGTTTCTTTTCCG
ACGCTTGCTGAAGTCAAGGTAGATCCTGCATCTGGGTCCGTAAGCTGCCC
TATCTCCTCCCCCAACCCATACCTCAACCACCCACAACACCAACAGCAAC
AGCGACCCCCTCCTCGAACCAACCCACCAGCAAACATCGCTAAAGTGGCC
AAATACCCACCCAGAACACCGCGGGTCAGTCCACCACCCCATTTACGGAA
CTAACTCGTCAGGCGCCACACATATGCTCCTTGCTGGGGCTTCGTTCCCT
CGTGGTGTACCGTCCTGCGCGCTCCCCCGCGATCTATAACGGACTGGAAG
GACTAATACTCGTTGGAGTGTCCCGCCTTTCGAACAGAAATGCTTGCAAT
GGAATTTTTCCTATTTTTGTTTTTGACTTGATGTTATTGGGAA

Sequences in the Contig:

SY0AAC22YB15FM1 SY0AAC23YA17FM1