Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4021
Length(NT) : 1763
Best Gene Model Blast : Link to GSTUMT00002107001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein MGG_00134
Accession: ref|XP_369110.2| Score: 1723 E_value: 0.0
KEGG Definition: hypothetical protein
Accession: mgr:MGG_00134 Score: 1723 E_value: 0.0
KOG Definition: No Hit Found
PFAM Definition: VWA, von Willebrand factor type A domain..
Pfam Number: pfam00092 Score: 121 E_value: 5e-07

Sequence:
>Contig4021
TTGGGTCAAGCATGGCAAGAGTTAGAGTGCTACCTCTTCTCAGAGATGCT
TATCTGTGTCAAGGACAAGAAGAGCTCTGCGTCTGCCTCCCAATGGACTA
ATGGCGTTAACAAAAAGCGAAGTGTTAAGTGCACGTTGAAAGGGTCTATT
CTCATAAAGAAACATTTGAAGAAAGTTAGCGATTCGAGTTCACCAGATGA
AAATATGCACATTCTCACCTTGAGTCTTTCTGTTGCCGAGCTGCCCCAAT
TTCATCTATTGTTTCCCACCAGTGCTCAGATGGATCAATGGCATCGTGCC
TTGCTGGATTTGAATGCTGTGGAGCTTGCATCGACAATGAGAAGCCCTCG
GTATGAAGACAAGCGGGGTTCTAATTCTGATGAAGATGACGACTTTCGCG
CTACGAAAACAACCAGGCGAGTATCCTCTGTCAACTCGGCCTATAGTGGG
ACACATGGTGGAGGGAGGTCTGTCGTCACGGCACCTACTGAGTATACTGC
GTCTATCAGAGGAGCAAAGCCACAGATATCCCCAGCTGTTCACATTCCTC
TCGATATTGTTGTCGTTATCCCGGTCTCATCATCCATGCAAGGTCTCAAA
ATCAATCTGATCCGCGACTCACTCAAATTTCTTATTCACAATCTTGGAGA
ACGGGATCGGATGGGGCTGGTGACATTTGGGTCGAGTAGTGGAGGAGTTG
CCTTGACTCCACTATCGGTAAAGAGCTGGAGCGGTTGGGCCAAAGTTGTC
AACTCTATTCGGCCTGTAGGCCAGAAGAGTTTGCGCACTGATGTGGTTGA
CGGAGCCAATGTCGCAATGGACTTGCTAATGCAGAGGAAATCGAGCAACC
CTATTGCATCTATTCTTTTGATTAGTGATTCCTCAACATCTGATACTGAA
AATGTGGATTTCGTGGTATCCAGGGCAGAAGCGGCAAAAATCACAATTCA
CTCATTCGGCCTTGGACTCACACATAAACCGGATACCATGATCGAACTTT
CAACTCGGACCAAGGGCCAATTCACTTACGTCAAGGATTGGATGATGTTG
CGCGAATGTGTGGCAGGATGCATCGGCGCTCTCCAAACGCTTTCGCACCA
GAACGCCAAACTCAGACTAAAACTCCCAGAAGGATCTCCCGCGAGGTTTG
TCAAGATCAGTGGAGCCTTACATGTGTCGAAGAGATCATCTGGGAGGGAA
GCAGAAGCTGCTCTTGGAGATCTTCACTTTGGTGACAAGAAAGATGTTTT
GGTTCAATTGGTTATCTCCCCGGATAGTTCGCAGGGCGAAATGGCTCCTC
AAGATGCATGGGAATCAATCGTGTCTGGATTAGAGGCATTAGGGGGCTCA
GCCGACCAGGATGAATCAAGGACTATCAGTATCGAGGAGGTGCCGCTCAT
CCAAGCGGATTTGACATACGGCGATATTCAGCGGGATGGAACACTTTCGC
AGCTGTCTCGGCCACATTTGCTCGCTATCACGATGCTTCCAGCCAGTCCT
CGGAAGGGCAGCAGGCCAGGATCGCCACCGATCCCCCCTCATCCGATGGT
GGTACAACGACGTATGGAACTATTAACCTCAGATATGTTGAGTCGTGCTT
TGACGCTTATATCTCGGGGTCAACACGATCGTGCGCATACCTTACTTACC
GAGACCCGAACAATCCTTAAGGGGCTTGGGAAAGGAGGTTTGCCGCCTCT
TCCCTCGCCCTCACCGTCCATCCCTCTGCCTGAAGTCCCTGAAGGGGGCT
CGAGTGGACATAC

Sequences in the Contig:

SY0AAA20YA17FM1 SY0AAA54YN15FM1 SY0AAC21YP22FM1
SY0AAD19YP03FM1 SY0AAD48YC07FM1 SY0AAD48YC21FM1