Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4020
Length(NT) : 673
Best Gene Model Blast : Link to GSTUMT00009163001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: RNase P and RNase MRP subunit (predicted)
Accession: ref|NP_588479.1| Score: 239 E_value: 1e-18
KEGG Definition: hypothetical protein; K03537 ribonuclease P subunit P14
Accession: spo:SPCC830.09c Score: 239 E_value: 6e-19
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG4639 Score: 254 E_value: 6e-23
PFAM Definition: RNase_P_Rpp14, Rpp14/Pop5 family. tRNA processing enzyme ribonuclease P (RNase P) consists of an RNA molecule associated with at least eight protein subunits, hPop1, Rpp14, Rpp20, Rpp25, Rpp29, Rpp30, Rpp38, and Rpp40. This protein is known as Pop5 in eukaryotes..
Pfam Number: pfam01900 Score: 222 E_value: 3e-19
Swissprot: Q9UU90|RNP2_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum

Sequence:
>Contig4020
TTGGCTCCCACTCATGTAACTCATCCCACCTATGAAGCCATGATACTCTA
GCCTACTTTCCTTTCTCCCTTCCTCCCTCCCATACACCACCGAAACACGA
CCACACCCCACCGCATCCCTCAAGATGGTCCGCTACAAAGCCCGCTATCT
CCTAATAACAATCCACTACCCAACCGAGCCCGCCCCCCCGGGCTCCAACC
CTACCCTCCCTTTTACCCACCCCTCCCATCCAAGCCTAACAAAACAATCC
CTCAGTAATCTCATACGCGATAGCCTAGCCCTCCAATTCGGCGACTACGG
TGCTGGCGCAGCAGGGAACATGACGGTAAAGTACTTCTCGCCCGTCACGT
CCACTGGGATAATCAAGGTCTCGAGAGCCCACTACAGGATGTTGTGGGCT
TCTCTGACCTTCATGAAGGAGGTGATGGGCAGGGGGGCAGTGGTTAGTGT
TGTTAGGGTTAGTGGAACAATTAAGAAGGTGCAGATCGAGGCCACCAGGA
GAGCAAAGGAGGGGATTCGACGGGCACGGGGGGTTGGAGGAGAGGGGGTT
GGGCTGGATGTTATGGACATTCTGGATGATGACGGTGACGGTGATGAGGG
CAGTGGGGATGAGGAATGAGGGTTTGGTTGGATGAAGCTGCATTGTAACG
CTACCTGGAGGGCGTTTGATAGA

Sequences in the Contig:

SY0AAA36YG07FM1 SY0AAC21YP07FM1