Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig402
Length(NT) : 1390
Best Gene Model Blast : Link to GSTUMT00007772001 E-value : 0.0
Numbers of ESTs : 602

Blast Results:

Nr Definition: hypothetical protein Kpol_1070p6
Accession: ref|XP_001643983.1| Score: 1467 E_value: 1e-160
KEGG Definition: ubi4; hypothetical protein
Accession: spo:SPBC337.08c Score: 1467 E_value: 1e-161
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0004 Score: 369 E_value: 8e-36
PFAM Definition: ubiquitin, Ubiquitin family. This family contains a number of ubiquitin-like proteins: SUMO (smt3 homologue), Nedd8, Elongin B, Rub1, and Parkin. A number of them are thought to carry a distinctive five-residue motif termed the proteasome-interacting motif (PIM), which may have a biologically significant role in protein delivery to proteasomes and recruitment of proteasomes to transcription sites..
Pfam Number: pfam00240 Score: 280 E_value: 2e-25
Swissprot: P61864|UBIQ_YEAST
Gene Ontology:
GO:0022625 = Cellular component: cytosolic large ribosomal subunit
GO:0005739 = Cellular component: mitochondrion
GO:0005515 = Molecular function: protein binding
GO:0003735 = Molecular function: structural constituent of ribosome
GO:0016567 = Biological process: protein ubiquitination
GO:0042254 = Biological process: ribosome biogenesis and assembly
GO:0006412 = Biological process: translation

Sequence:
>Contig402
TTGGGGGGACAACTTTGTACAAAACACTTGGTAAAAACACCTTTCTCCCC
CATCTACTACGAAACTCTTCTACTCAAAACTTCCATTTAGCAAAAACATC
TTCCATAAAAACAATCAGCCATGCAGATCTTCGTCAAAACTCTCACTGGA
AAAACCATTACCCTTGAGGTGGAATCGTCGGACACTATCGACAACGTCAA
GTCTAAGATTCAGGACAAGGAGGGAATTCCTCCAGATCAGCAACGTTTGA
TCTTTGCTGGAAAGCAGCTTGAGGACGGACGCACCCTCTCAGATTACAAC
ATCCAAAAGGAGTCTACCCTTCATCTTGTTCTCCGTCTTCGTGGCGGTAT
GCAAATCTTTGTAAAGACTCTAACTGGCAAGACAATCACCCTCGAGGTGG
AGTCTTCTGATACTATTGACAATGTCAAGTCAAAGATCCAGGATAAGGAG
GGCATCCCCCCAGACCAGCAGCGCTTGATTTTCGCCGGCAAGCAACTTGA
GGATGGTCGTACCCTTTCCGATTATAACATTCAGAAAGAGTCCACCCTTC
ACTTGGTTCTTCGTCTTCGTGGCGGAATGCAAATCTTTGTCAAGACCTTA
ACCGGCAAGACAATCACCCTCGAGGTCGAGTCCTCGGACACCATTGACAA
CGTCAAGTCGAAAATCCAAGATAAGGAGGGTATTCCTCCAGACCAGCAAC
GATTGATCTTCGCTGGAAAGCAGCTTGAGGATGGCCGTACCCTCTCTGAT
TACAACATTCAGAAGGAGTCTACCCTTCATCTCGTCCTTCGACTTCGTGG
TGGAATGCAAATTTTCGTTAAAACTTTGACCGGAAAGACTATCACCCTCG
AGGTGGAGTCTTCTGACACAATCGACAATGTCAAGTCGAAGATTCAGGAT
AAGGAGGGTATTCCTCCAGACCAGCAGCGCTTGATCTTTGCTGGTAAGCA
GTTGGAGGATGGTCGTACTCTTTCCGATTATAACATTCAGAAAGAGTCCA
CCCTTCACTTGGTTCTTCGTCTTCGTGGCGGGTCTTTGTAAGGTTTAGAA
ATGTGTTACGACTGAACGGATCATGTGATTGTTGTGGCTTGTAAAATGAT
TGGATGGTTTCCTATTTTGATTTTTGTTTCTTCTACTGGGTTCTGGGTGT
TTGGGTCGAGTACCCTGGCTTGTATCAGATTGGTGTTTACCAAATGATAT
TCTCTTCTGACGCAACAAACGTTTTTTCCTGTTAGGGCGAGTGATTTGCA
CGGTAGCTATCCTGGTACACCCAAGGTACTAATAAGCTGGGCCAATAATA
TTATCCATGTGCGCCCGCTTCTTACTTTGGGGAAGGTGAACTTTTTTCAC
TGGTGATTGCGTAATGTTATTCCAGTATGATTCGAGTGTT

Sequences in the Contig:

SY0AAA10YG13FM1 SY0AAA11YA08FM1 SY0AAA11YH20FM1
SY0AAA11YM03FM1 SY0AAA11YO05FM1 SY0AAA13YE08FM1
SY0AAA13YJ16FM1 SY0AAA13YK19FM1 SY0AAA13YK20FM1
SY0AAA13YN04FM1 SY0AAA14YB05FM1 SY0AAA14YK17FM1
SY0AAA14YM01FM1 SY0AAA14YN19FM1 SY0AAA14YO16FM1
SY0AAA15YC03FM1 SY0AAA15YD22FM1 SY0AAA15YG19FM1
SY0AAA15YI09FM1 SY0AAA15YJ24FM1 SY0AAA16YA03FM1
SY0AAA16YA16FM1 SY0AAA16YD07FM1 SY0AAA16YI23FM1
SY0AAA16YK04FM1 SY0AAA16YO08FM1 SY0AAA16YO14FM1
SY0AAA17YP08FM1 SY0AAA17YP22FM1 SY0AAA18YA24FM1
SY0AAA18YE15FM1 SY0AAA18YF03RM1 SY0AAA18YH23RM1
SY0AAA18YL22FM1 SY0AAA18YL22RM1 SY0AAA19YC05FM1
SY0AAA19YI14FM1 SY0AAA1YE17FM1 SY0AAA1YF18FM1
SY0AAA1YJ03FM1 SY0AAA20YA19FM1 SY0AAA20YA19RM1
SY0AAA20YL10FM1 SY0AAA20YL10RM1 SY0AAA20YO06RM1
SY0AAA20YP11FM1 SY0AAA21YB19FM1 SY0AAA21YC05FM1
SY0AAA21YG19RM1 SY0AAA22YL14FM1 SY0AAA22YL14RM1
SY0AAA22YO18FM1 SY0AAA23YB19FM1 SY0AAA23YF02FM1
SY0AAA23YJ17FM1 SY0AAA23YO24FM1 SY0AAA23YO24RM1
SY0AAA24YD16FM1 SY0AAA24YD16FM2 SY0AAA24YG03FM1
SY0AAA24YG03FM2 SY0AAA24YG12FM1 SY0AAA24YG12FM2
SY0AAA24YJ10FM2 SY0AAA24YM19FM1 SY0AAA24YM19FM2
SY0AAA24YO01FM1 SY0AAA24YO01FM2 SY0AAA25YA03FM1
SY0AAA25YJ10FM1 SY0AAA25YL01FM1 SY0AAA25YL01RM1
SY0AAA25YO19FM1 SY0AAA26YA15FM1 SY0AAA26YI18FM1
SY0AAA26YI18RM1 SY0AAA26YK01FM1 SY0AAA26YM02FM1
SY0AAA27YF17FM1 SY0AAA27YN19FM1 SY0AAA28YF06FM1
SY0AAA28YF10FM1 SY0AAA28YI22FM1 SY0AAA28YK06FM1
SY0AAA28YL12FM1 SY0AAA28YP21FM1 SY0AAA29YD19FM1
SY0AAA29YH17FM1 SY0AAA2YI08FM1 SY0AAA2YO04FM1
SY0AAA2YP02FM1 SY0AAA30YI03RM1 SY0AAA30YJ10RM1
SY0AAA30YK09FM1 SY0AAA30YK15FM1 SY0AAA31YD14FM1
SY0AAA31YD20FM1 SY0AAA31YJ04FM1 SY0AAA31YK16FM1
SY0AAA31YL02FM1 SY0AAA31YL02RM1 SY0AAA32YC21FM1
SY0AAA32YF16FM1 SY0AAA32YF16RM1 SY0AAA32YL09FM1
SY0AAA33YA05FM1 SY0AAA33YG06FM1 SY0AAA33YG12FM1
SY0AAA33YH06FM1 SY0AAA33YN07FM1 SY0AAA34YK03FM1
SY0AAA34YN18FM1 SY0AAA34YO16FM1 SY0AAA35YA16FM1
SY0AAA35YC13FM1 SY0AAA35YG08FM1 SY0AAA35YK13FM1
SY0AAA36YD19FM1 SY0AAA36YH11FM1 SY0AAA36YO20FM1
SY0AAA37YC18FM1 SY0AAA37YE19FM1 SY0AAA37YG06FM1
SY0AAA37YH24FM1 SY0AAA37YM07FM1 SY0AAA37YM14FM1
SY0AAA37YO15FM1 SY0AAA38YA01FM1 SY0AAA38YD07FM1
SY0AAA38YN04FM1 SY0AAA38YO23FM1 SY0AAA39YB05FM1
SY0AAA39YB10FM1 SY0AAA39YK14FM1 SY0AAA39YP03FM1
SY0AAA39YP09FM1 SY0AAA3YD12FM1 SY0AAA3YG18FM1
SY0AAA3YM14FM1 SY0AAA3YN18FM1 SY0AAA40YK17FM1
SY0AAA40YP09FM1 SY0AAA41YJ06FM1 SY0AAA42YB07FM1
SY0AAA42YH24FM1 SY0AAA42YM18FM1 SY0AAA42YN02FM1
SY0AAA42YO05FM1 SY0AAA43YA10FM1 SY0AAA43YC12FM1
SY0AAA43YD08FM1 SY0AAA43YJ01FM1 SY0AAA43YL17FM1
SY0AAA43YP07FM1 SY0AAA44YC05FM1 SY0AAA44YD22FM1
SY0AAA44YI24FM1 SY0AAA44YJ18FM1 SY0AAA44YL03FM1
SY0AAA44YO22FM1 SY0AAA45YB04FM1 SY0AAA45YB10FM1
SY0AAA46YB06FM1 SY0AAA46YE23FM1 SY0AAA47YD19FM1
SY0AAA47YI03FM1 SY0AAA47YI05FM1 SY0AAA47YM10FM1
SY0AAA47YM17FM1 SY0AAA47YN21FM1 SY0AAA48YC20FM1
SY0AAA48YF07FM1 SY0AAA49YA06FM1 SY0AAA49YB23FM1
SY0AAA49YE02FM1 SY0AAA49YL14FM1 SY0AAA49YN05FM1
SY0AAA4YB11FM1 SY0AAA4YE16FM1 SY0AAA4YO19FM1
SY0AAA50YH10FM1 SY0AAA50YJ14FM1 SY0AAA50YK08FM1
SY0AAA52YD23FM1 SY0AAA52YH10FM1 SY0AAA52YL13FM1
SY0AAA52YP22FM1 SY0AAA53YA04FM1 SY0AAA53YA15FM1
SY0AAA53YB22FM1 SY0AAA53YC09FM1 SY0AAA53YJ01FM1
SY0AAA53YL19FM1 SY0AAA54YA11FM1 SY0AAA54YH17FM1
SY0AAA55YA05FM1 SY0AAA55YE16FM1 SY0AAA55YK01FM1
SY0AAA56YD11FM1 SY0AAA56YF05FM1 SY0AAA56YI06FM1
SY0AAA57YB16FM1 SY0AAA57YC18FM1 SY0AAA57YE01FM1
SY0AAA57YK16FM1 SY0AAA57YK20FM1 SY0AAA58YH06FM1
SY0AAA58YI10FM1 SY0AAA58YJ09FM1 SY0AAA59YB19FM1
SY0AAA59YD19FM1 SY0AAA59YH12FM1 SY0AAA59YL19FM1
SY0AAA5YB08FM1 SY0AAA5YB12FM1 SY0AAA5YC15FM1
SY0AAA60YB16FM1 SY0AAA60YF06FM1 SY0AAA60YF23FM1
SY0AAA60YL04FM1 SY0AAA60YL17FM1 SY0AAA61YA02FM1
SY0AAA61YB10FM1 SY0AAA61YD04FM1 SY0AAA61YE10FM1
SY0AAA61YL02FM1 SY0AAA62YD02FM1 SY0AAA62YE10FM1
SY0AAA62YH17FM1 SY0AAA62YI04FM1 SY0AAA62YK05FM1
SY0AAA62YL12FM1 SY0AAA63YG09FM1 SY0AAA63YO02FM1
SY0AAA63YP10FM1 SY0AAA6YC04FM1 SY0AAA6YF20FM1
SY0AAA6YJ03FM1 SY0AAA6YK08FM1 SY0AAA6YK10FM1
SY0AAA6YO04FM1 SY0AAA6YP20FM1 SY0AAA7YL09FM1
SY0AAA8YF07FM1 SY0AAA8YP04FM1 SY0AAA9YB14FM1
SY0AAA9YC04FM1 SY0AAA9YL20FM1 SY0AAA9YN20FM1
SY0AAA9YO21FM1 SY0AAB10YD05FM1 SY0AAB10YH04FM1
SY0AAB10YH09FM1 SY0AAB11YH12FM1 SY0AAB11YK09FM1
SY0AAB11YP11FM1 SY0AAB12YF07FM1 SY0AAB12YG14FM1
SY0AAB12YH12FM1 SY0AAB12YI16FM1 SY0AAB12YN08FM1
SY0AAB13YA18FM1 SY0AAB13YC17FM1 SY0AAB13YJ04FM1
SY0AAB13YM02FM1 SY0AAB14YJ12FM1 SY0AAB16YM21FM1
SY0AAB17YD01FM1 SY0AAB17YD12FM1 SY0AAB17YE04FM1
SY0AAB17YK08FM1 SY0AAB17YN21FM1 SY0AAB17YO06FM1
SY0AAB18YI19FM1 SY0AAB19YB12FM1 SY0AAB19YF23FM1
SY0AAB19YG24FM1 SY0AAB19YK17FM1 SY0AAB1YA19FM1
SY0AAB1YG06FM1 SY0AAB1YG14FM1 SY0AAB1YJ08FM1
SY0AAB1YJ24FM1 SY0AAB1YO17FM1 SY0AAB1YP07FM1
SY0AAB20YE24FM1 SY0AAB20YK16FM1 SY0AAB21YC22FM1
SY0AAB21YD24FM1 SY0AAB21YI20FM1 SY0AAB21YM04FM1
SY0AAB22YE19FM1 SY0AAB22YJ16FM1 SY0AAB22YL06FM1
SY0AAB23YI17FM1 SY0AAB23YJ05FM1 SY0AAB23YM20FM1
SY0AAB23YP08FM1 SY0AAB24YF18FM1 SY0AAB24YJ14FM1
SY0AAB24YL14FM1 SY0AAB25YC08FM1 SY0AAB25YE23FM1
SY0AAB25YF09FM1 SY0AAB25YF23FM1 SY0AAB25YJ12FM1
SY0AAB25YL22FM1 SY0AAB25YO05FM1 SY0AAB25YO06FM1
SY0AAB26YC10FM1 SY0AAB26YD12FM1 SY0AAB26YF02FM1
SY0AAB26YI02FM1 SY0AAB26YJ17FM1 SY0AAB26YJ20FM1
SY0AAB26YK09FM1 SY0AAB27YD06FM1 SY0AAB27YE13FM1
SY0AAB27YH14FM1 SY0AAB27YI09FM1 SY0AAB27YI23FM1
SY0AAB28YG14FM1 SY0AAB28YG15FM1 SY0AAB28YJ04FM1
SY0AAB28YK17FM1 SY0AAB28YN19FM1 SY0AAB28YO21FM1
SY0AAB29YI09FM1 SY0AAB29YK24FM1 SY0AAB29YP01FM1
SY0AAB29YP06FM1 SY0AAB2YB10FM1 SY0AAB2YC02FM1
SY0AAB2YE15FM1 SY0AAB2YF13FM1 SY0AAB2YF20FM1
SY0AAB2YI23FM1 SY0AAB2YK24FM1 SY0AAB2YP01FM1
SY0AAB30YA13FM1 SY0AAB30YD12FM1 SY0AAB30YE11FM1
SY0AAB30YE16FM1 SY0AAB30YE23FM1 SY0AAB30YG22FM1
SY0AAB30YL15FM1 SY0AAB31YF03FM1 SY0AAB31YI05FM1
SY0AAB32YF17FM1 SY0AAB32YI04FM1 SY0AAB32YO19FM1
SY0AAB33YA15FM1 SY0AAB33YB18FM1 SY0AAB33YK17FM1
SY0AAB33YL11FM1 SY0AAB33YP06FM1 SY0AAB34YA09FM1
SY0AAB34YB15FM1 SY0AAB34YE03FM1 SY0AAB34YJ12FM1
SY0AAB34YK04FM1 SY0AAB34YN06FM1 SY0AAB35YB11FM1
SY0AAB35YF07FM1 SY0AAB35YG08FM1 SY0AAB35YN23FM1
SY0AAB36YC20FM1 SY0AAB36YF06FM1 SY0AAB37YG19FM1
SY0AAB37YH16FM1 SY0AAB37YJ16FM1 SY0AAB38YD03FM1
SY0AAB38YE16FM1 SY0AAB38YF09FM1 SY0AAB38YG01FM1
SY0AAB38YG10FM1 SY0AAB38YG22FM1 SY0AAB38YK03FM1
SY0AAB39YJ13FM1 SY0AAB39YO01FM1 SY0AAB39YP21FM1
SY0AAB3YL08FM1 SY0AAB40YJ06FM1 SY0AAB41YG11FM1
SY0AAB41YH22FM1 SY0AAB41YN14FM1 SY0AAB42YE03FM1
SY0AAB42YO04FM1 SY0AAB42YO19FM1 SY0AAB42YP08FM1
SY0AAB43YE19FM1 SY0AAB43YF14FM1 SY0AAB43YH07FM1
SY0AAB43YJ03FM1 SY0AAB43YN20FM1 SY0AAB44YE19FM1
SY0AAB44YJ16FM1 SY0AAB44YM21FM1 SY0AAB45YC16FM1
SY0AAB45YI02FM1 SY0AAB45YI05FM1 SY0AAB45YM13FM1
SY0AAB46YA06FM1 SY0AAB46YA13FM1 SY0AAB46YB07FM1
SY0AAB46YB08FM1 SY0AAB46YC12FM1 SY0AAB46YD01FM1
SY0AAB46YF23FM1 SY0AAB46YI12FM1 SY0AAB46YL02FM1
SY0AAB47YB13FM1 SY0AAB47YK14FM1 SY0AAB47YM15FM1
SY0AAB48YF04FM1 SY0AAB48YH22FM1 SY0AAB48YI13FM1
SY0AAB48YM20FM1 SY0AAB49YP08FM1 SY0AAB4YJ07FM1
SY0AAB50YB02FM1 SY0AAB50YD12FM1 SY0AAB50YF09FM1
SY0AAB50YI11FM1 SY0AAB50YM09FM1 SY0AAB50YM21FM1
SY0AAB50YN03FM1 SY0AAB50YN20FM1 SY0AAB50YO24FM1
SY0AAB50YP02FM1 SY0AAB50YP17FM1 SY0AAB51YF18FM1
SY0AAB51YH22FM1 SY0AAB51YI01FM1 SY0AAB51YJ08FM1
SY0AAB51YP05FM1 SY0AAB51YP19FM1 SY0AAB52YC09FM1
SY0AAB52YE11FM1 SY0AAB52YF10FM1 SY0AAB52YH09FM1
SY0AAB52YH13FM1 SY0AAB52YJ04FM1 SY0AAB53YD20FM1
SY0AAB53YE11FM1 SY0AAB53YH21FM1 SY0AAB54YB10FM1
SY0AAB54YF18FM1 SY0AAB54YI06FM1 SY0AAB54YJ02FM1
SY0AAB54YL17FM1 SY0AAB54YM10FM1 SY0AAB54YN24FM1
SY0AAB55YB08FM1 SY0AAB55YF13FM1 SY0AAB55YJ09FM1
SY0AAB55YK13FM1 SY0AAB55YN09FM1 SY0AAB55YO13FM1
SY0AAB55YO24FM1 SY0AAB56YA20FM1 SY0AAB56YI21FM1
SY0AAB56YJ10FM1 SY0AAB57YE18FM1 SY0AAB57YF18FM1
SY0AAB57YG08FM1 SY0AAB57YH17FM1 SY0AAB57YM20FM1
SY0AAB58YD09FM1 SY0AAB58YE06FM1 SY0AAB58YI10FM1
SY0AAB58YJ11FM1 SY0AAB58YP24FM1 SY0AAB59YD13FM1
SY0AAB59YK13FM1 SY0AAB59YN16FM1 SY0AAB59YN21FM1
SY0AAB59YO01FM1 SY0AAB59YO14FM1 SY0AAB59YP06FM1
SY0AAB5YB11FM1 SY0AAB5YO19FM1 SY0AAB5YO24FM1
SY0AAB60YA04FM1 SY0AAB60YB12FM1 SY0AAB60YC12FM1
SY0AAB60YG07FM1 SY0AAB60YL06FM1 SY0AAB60YM23FM1
SY0AAB60YN09FM1 SY0AAB60YO22FM1 SY0AAB60YO23FM1
SY0AAB61YA11FM1 SY0AAB61YC03FM1 SY0AAB61YH13FM1
SY0AAB61YN19FM1 SY0AAB6YC10FM1 SY0AAB6YF13FM1
SY0AAB6YH18FM1 SY0AAB6YJ02FM1 SY0AAB7YE16FM1
SY0AAB7YK09FM1 SY0AAB8YB03FM1 SY0AAB8YF11FM1
SY0AAB8YH15FM1 SY0AAB8YN02FM1 SY0AAB9YF14FM1
SY0AAB9YN16FM1 SY0AAB9YP10FM1 SY0AAC10YG18FM1
SY0AAC11YH20FM1 SY0AAC12YN09FM1 SY0AAC19YN10FM1
SY0AAC19YN10RM1 SY0AAC1YJ09FM1 SY0AAC1YM23FM1
SY0AAC21YL17FM1 SY0AAC22YF01FM1 SY0AAC29YJ07FM1
SY0AAC2YL18FM1 SY0AAC2YO20FM1 SY0AAC30YM10FM1
SY0AAC31YK21FM1 SY0AAC32YO15FM1 SY0AAC33YP19FM1
SY0AAC35YC15FM1 SY0AAC39YO07FM1 SY0AAC39YP08FM1
SY0AAC3YP20FM1 SY0AAC41YB01FM1 SY0AAC41YE05FM1
SY0AAC41YK20FM1 SY0AAC41YO12FM1 SY0AAC44YD02FM1
SY0AAC44YK18FM1 SY0AAC45YG11FM1 SY0AAC46YP12FM1
SY0AAC47YA21FM1 SY0AAC49YL16FM1 SY0AAC4YF17FM1
SY0AAC53YP14FM1 SY0AAC54YC14FM1 SY0AAC54YI19FM1
SY0AAC55YH17FM2 SY0AAC55YN13FM2 SY0AAC56YA04FM1
SY0AAC56YC05FM1 SY0AAC57YJ07FM1 SY0AAC60YL19FM1
SY0AAC61YA22FM1 SY0AAC61YI16FM1 SY0AAC6YL19FM1
SY0AAC8YE19FM1 SY0AAD11YE04FM1 SY0AAD11YI02FM1
SY0AAD11YK20FM1 SY0AAD12YD10FM1 SY0AAD12YM11FM1
SY0AAD13YA21FM1 SY0AAD13YH19FM1 SY0AAD13YI14FM1
SY0AAD13YJ04FM1 SY0AAD14YF20FM1 SY0AAD18YC24FM1
SY0AAD18YI10FM1 SY0AAD22YF06FM1 SY0AAD26YG02FM1
SY0AAD26YO02FM1 SY0AAD27YL20FM1 SY0AAD27YO04FM1
SY0AAD28YN15FM1 SY0AAD29YH12FM1 SY0AAD29YM11FM1
SY0AAD2YI22FM1 SY0AAD30YK09FM1 SY0AAD31YL03FM1
SY0AAD32YL17FM1 SY0AAD34YF20FM1 SY0AAD36YO22FM1
SY0AAD38YJ07FM1 SY0AAD39YA05FM1 SY0AAD41YI14FM1
SY0AAD44YH15FM1 SY0AAD44YM23FM1 SY0AAD47YM11FM1
SY0AAD48YP08FM1 SY0AAD4YF19FM1 SY0AAD4YL24FM1
SY0AAD51YG03FM1 SY0AAD52YH05FM1 SY0AAD52YP04FM1
SY0AAD55YG21FM1 SY0AAD55YK04FM1 SY0AAD55YO14FM1
SY0AAD56YB11FM1 SY0AAD57YC16FM1 SY0AAD59YP09FM1
SY0AAD61YD21FM1 SY0AAD8YJ11FM1 SY0AAD8YP05FM1
SY0AAD9YE01FM1 SY0AAD9YO22FM1