Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4019
Length(NT) : 2938
Best Gene Model Blast : Link to GSTUMT00004217001 E-value : 0.0
Numbers of ESTs : 24

Blast Results:

Nr Definition: fungal specific transcription factor domain protein
Accession: ref|XP_001268734.1| Score: 1354 E_value: 1e-160
KEGG Definition: predicted protein
Accession: aor:AO090005001203 Score: 1300 E_value: 1e-154
KOG Definition: No Hit Found
PFAM Definition: Fungal_trans, Fungal specific transcription factor domain..
Pfam Number: pfam04082 Score: 215 E_value: 1e-17
Swissprot: O59741|YN25_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig4019
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTTTCTTGCTTCGTTTTCCA
AAACCCAGCCCTCCGTTACCAACGGGCAGGTTAGCTGCCTACCGCACCAG
CTGCTAGGTCGGTGCCTTTCTTTTTTGTCCTGCCTCCGCCCTTCTCTGCC
TGTCACTGCCTCCGGTTGTGTCGTTGTCATCGCCGCCGCCGCCGCCGTAA
GTGGTTGGTTCCGTGTCATTTGGTTTGCTTGATCATTCTTTTCTCTCTCC
CCGTTCGCTGTTGCAGTGTTGCTCTTGTTCCTCCCTCCTTCGTTCCTCAT
CCACATCTTCCAACGCCTCTCGGCCTACTCGTTTCAAGAACACCACCCAA
GCGCACCCGCTGCAGAGGAACTGCGCAAAAGGTGAAAAAGAAAAGAAAAG
AAAAGAAAAGGGGAGAAAATCGGGGAAAAAAGGAAATAAAAATAAAAAAC
CCCCCGGAAGGAAAAAGGATAGAAAGGGAGACCACTGGCGGGAAAAAAGA
AGTCATCTCGTGCAGCCCCTTCTAAAAGAAGGCCTTCCCAAGAAGAGGAA
AGAAGAAAAAAGAAAAAGAAAAAAGAGATCCGCCCTCCCCCTTCATCTTT
TCTTACTAAAATCTCATTCTACCCATCTTCTTCCGTCTTTCATTGTGTGA
ACTACCTCACCGAATTGCGCATTTCACAGTCCCCCCTGAACTGGTAATCC
AGAGCTGTCGTGACGCCTCTGTTGCTCTACAGCTATCACTACGCTGCCTA
AGATTGACGAGGACTGAGACACTTGAAATCCGGCTTCTTGACAAGGTCTG
GGAGTCAGCTGAATGCATGCAATTTCGCCCCTGTTGTTGAAAAAAAGATA
TCCAATTTCAACGTTTCCCCTCTGTCTCTCTTCTCGACTGCATCTTCATT
TCCTGTGACAGCGTCCCTGAACAACCACATCGTCTAACGGCTGCAAGCAT
TGCCTTAGCCTTTTGGAGGAAACTGCGAATATAGCATTATGGAAGACAGA
GCAAGTTCAATTCAACACCCGCCTTTTCAAGGTACACTTCCTCCGCCAAA
TGGAATGCATTCCTATGACCCGGGTATGAACACTCCCACATCGGCTCCAC
TTCCGGGCACCGCCAGCGCTCAGAGTCAACACATGGGTATCAACAATTCA
AACCACCCTTCTTTTCAGCCATATAATTCGAACTCTGTTTCTCCTGGCCC
TTCTCGCGACGGACAAATGCCTTCACCATCTGCTGGAACGCCAATGCATC
CGGGTCAAGTAATGACCGGAACACAGAAAAGGGCTTATCGACAGCGGCGG
AAGGATCCCTCTTGCGATGCGTGTAGAGAGCGCAAAGTCAAGGTCTATCT
TATTTTTCTACTTCTTACTTGAAATTTCCTGGATTCCTCCTCGCGATCCC
CCGAATCGAACCTTATATTAGACAAATAAGCTTACTCTTTACTTTTTTGG
CCGAACAGTGCGATGCCACAGATGTTGCGAGCTGTTCGGAATGCGCTTCA
AGGAATGTCAAATGCCAATTCACCAAAGAGACTAACCGTCGCATGTCATC
GATAAAACAGGTGCAGGATCTCGAGAAACAACTACTCGCAGCGAAGGAAC
AGATTCGAAAGCTTATGAATGGACAGCAAGCAAAGGAGAACATGTTGGAG
AGTGGAGGCGCAGATAGCAACGCTCCAGATATACCTATAACGGTTCCTGA
CCTAAACTCGAATCCACAAAGGCGACCTCGACCACCGGTTACGCAGGATT
TAACTGATGTCCGGGCGCACCTCCGTAATTACAGTCGAGGTGTTTTCAAA
CCTCCACCACCCTATAGACAGGTCGGGCTTCAATCCAATTTTTCTCCACC
ACTTCCAGAGCTTCCTCCACAATCAGTCGCAGATGCTATTTTAGCCCAGT
ATTACCAGACGATACATTCAGTCATCCCTATTCTTCATTGGCCGCAGTTT
GTGCAACGTTACGAGGAGGTGCGGAAGCAAGGTGATTTGTCGGGAGTTCC
GCCCTATTGGGGGTCTGTGCTGTTTGCCGTCTTTGCTTGTGGTTTGCTCT
ATACTGTGGATCCACAGATAAAAGCGAGTTATCCCGACCACGGAAGATCG
TTTATTGGATATTCCCGGCAATTGACGGATTTGTTTAACGACGAATTTAC
CATAGACCATGCACGATCGGCGCTACTTACCAGTATTTTCCTCACAGAGT
TAAATTGTAAATCCGCCGCTTGGACTTGGTTGGGGTCGACCGTCAGAATT
GCGCAAGACATAGGGTTGCATCGGGAGAGTGGGCCGTGGCCAGTTGTCGA
AGGAGAGATGCGTCGTCGGGTTTGGTGGGGAATATATGTGTGGGATCGAC
TTTTATCTGTCGAGCTTGGGCGAGTCCTGCTGATCGAAGACCAGGATTGT
GATATTTCTTTGCCTTGTGCCCTTGATGACCATTTCATCTACGACGAGGG
CTTGCTGGTACCTAACGGCTCATCACAACAGCCTGCGAATTTCCTCCTGA
CAACCATTCATGTGGTTCGTCTTATCGGACCATTGTTGAAAAACCTTCAA
GTACCTGTCATATCTCCACAAAATCTAGCTTGCTTTGATACCCACTTCAC
GTCGTGCTTGTCGGCATTCCCTGCCAATTGCCATATTAACCATCCTAACC
CTCTTGAACCCCGACACCTATCCCCTATATTCCATCTTCAGAACTGCCGG
CTAGTGCTTCACCGTCATAACTTGTCCACATTGTGTCCCTTTGAGGCTCG
TGCGGCAGCCCTGGATTCTTGTGTCTCGGCTGCCAAAGACACAGTTCATT
TCCTATCTCGTGCCATGCAATACGGCTATGGTACGGGATGGCAGAACATG
ATGGCAACATGTGCGTCTACAATGATCTGCACTCATATCTGGCGTTGCTC
ATTGTTTTTTATGTTTCCGTGGGTTTTTATAACGAGGC

Sequences in the Contig:

SY0AAA20YD08FM1 SY0AAA30YK01FM1 SY0AAA33YM20FM1
SY0AAA37YD15FM1 SY0AAA38YL04FM1 SY0AAA42YK14FM1
SY0AAA44YP21FM1 SY0AAA53YI15FM1 SY0AAA55YH01FM1
SY0AAA6YP15FM1 SY0AAA7YC21FM1 SY0AAA7YH18FM1
SY0AAB1YO12FM1 SY0AAB23YI02FM1 SY0AAB36YK06FM1
SY0AAB42YL02FM1 SY0AAB43YG12FM1 SY0AAC21YJ13FM1
SY0AAC21YO22FM1 SY0AAC24YH14FM1 SY0AAC5YJ01FM1
SY0AAD26YO22FM1 SY0AAD47YF04FM1 SY0AAD59YA10FM1