Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4018
Length(NT) : 748
Best Gene Model Blast : Link to GSTUMT00006139001 E-value : 0.0
Numbers of ESTs : 12

Blast Results:

Nr Definition: RNA helicase
Accession: ref|XP_721738.1| Score: 499 E_value: 1e-48
KEGG Definition: CaO19.9230; RNA helicase
Accession: cal:CaO19_9230 Score: 499 E_value: 5e-49
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0332 Score: 506 E_value: 5e-52
PFAM Definition: DEAD, DEAD/DEAH box helicase. Members of this family include the DEAD and DEAH box helicases. Helicases are involved in unwinding nucleic acids. The DEAD box helicases are involved in various aspects of RNA metabolism, including nuclear transcription, pre mRNA splicing, ribosome biogenesis, nucleocytoplasmic transport, translation, RNA decay and organellar gene expression..
Pfam Number: pfam00270 Score: 174 E_value: 1e-13
Swissprot: Q5AJD0|DBP5_CANAL

Sequence:
>Contig4018
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGAAGTTTGCTTCAGCCTT
CACCAACCCCACAGTCCATCAGATTAATTCAATATCCCGATACCTTTTCT
CATCTCAGCACTTCATCTCCTCCATCACTGCTGACTTGACTTCTTGAGTC
TTCCCCCTATCCTGCACTGGGCCGCTGGTTTTGTTTTTTGACCTCGTCAT
CGACAATGGCCGAGCAGCCAGCTTCTCTCGAGTCTCGAATCGGGAAGGTA
CCTGAAGTCCCGGTTGGTGCTGCTGTTACCACCGATAAAGCATCTACCTC
CATACCACCTCCTGCGGCGGGAGGCTCAGGTCTCGATGAGCCCCAATATG
AAGTTGCTGTAAAGCTTGCCGACCTACAGGGGGATCCTAATAGTCCCCTC
TATTCCGTCAAAAAATTTGAAGATCTCGGACTCTCCAAGGAGCTTCTAGA
GGGTGTTTATTTCATGAACTTTAAGAAGCCGTCAAAGATCCAAGAACGAG
CACTCCCCCTCCTCTTATCAGACCCCCCCACAAATATGATTGGCCAATCA
CAATCTGGGACTGGGAAAACAGCGGCCTTCGTTTTGACAATGTTGACTCG
TGTTGACATGTCCGTCAGCAATGTCCAAGCTCTCTGTTTGGCTCCGTCTC
GAGAGCTGGCTAGACAGATTATGAGTGTTGTTCAAACCATGGGTCAATTT
ACCGACATCAGAACTCAGTTTGCTATCCCGAATATGGTTCAACGTGGT

Sequences in the Contig:

SY0AAA10YC17FM1 SY0AAA16YD24FM1 SY0AAC15YM13FM1
SY0AAC21YO17FM1 SY0AAC2YO18FM1 SY0AAC32YA11FM1
SY0AAC40YG03FM1 SY0AAC56YK18FM1 SY0AAC9YO07FM1
SY0AAD24YN19FM1 SY0AAD42YN17FM1 SY0AAD47YL08FM1