Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4017
Length(NT) : 820
Best Gene Model Blast : Link to GSTUMT00000551001 E-value : 1e-119
Numbers of ESTs : 2

Blast Results:

Nr Definition: MAP kinase MpkB/Fus3
Accession: ref|XP_001258423.1| Score: 281 E_value: 2e-23
KEGG Definition: hypothetical protein
Accession: ang:An08g10670 Score: 280 E_value: 1e-23
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0660 Score: 243 E_value: 1e-21
PFAM Definition: No Hit Found
Swissprot: Q00859|MAPK_FUSSO

Sequence:
>Contig4017
CCCGCATGAATTTGACTTTTATTTTCCCATCCGCTCATTCCCACAAGTAA
TAAACCCCCCTCACAAACCTAAAAGGCAAGAAAACTAAGGAAATGGAGGA
GATAAACATTGGTGGGATAGTAAGAGGAATTTCCGAAATACGAAACGAGG
ACCACGAATCCATTGGTATAATCAGTCAAGAAAAACATAAGGTGTAAACA
TCAATCCCAAAAGAAAACCCAAAGCCCGGGGCTCCCCTCACTCAAACATC
TGGGGCATTAAACCCATTGCTTTCACCGCATAATCTCCTCAAAGATAAGC
ATCTTTAGTTGCTCTTTGCTCAGTTCATCCTTTCTTCTATCAAAGTCAAA
GAACTCATCGGGAATTGGCGGTGCGGTGGGTTCATCCTCAGGGTCATGGT
AAGGCTCAAGGTAAGGGTGCTTTAAAGCATCTTCGACAGTAATTCTTTTC
GCAGGGTTAAATGCCAATAGCTTCTCTAAAAGATCCAGTCAAATAACGGG
TGCTCTCGTATCGATGGATATCAGTGCGAACGGTTGTTGTAACACCGGTA
GAGTATTGGGTGTGTTGTTAGACCGGGGGAACGCAGTGTTAGGATAGGAT
AGGATAGGATAGCGGGAGTGTTGATGTACTCGCTTCCTTTGTTCAGCGGT
CTGGCCTCTCCCTCCCCTGGAAATTGGGTTTCTCTCGGCTGTCCGCCTTC
GTCACACTAAGCCTTTGCTTTCGAGAATATTTTGTCCGGCGGAAAAGGGG
AAGGAAGTTGTCTTTGAATGAAGCCTCTGTATCGTGTGGTAGGTTGTATG
GGAAACGATGGGAGTTGAGA

Sequences in the Contig:

SY0AAB19YC06FM1 SY0AAC21YO16RM1