Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4016
Length(NT) : 696
Best Gene Model Blast : Link to GSTUMT00000285001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_02157
Accession: ref|XP_001792775.1| Score: 331 E_value: 3e-29
KEGG Definition: hypothetical protein
Accession: ncr:NCU05606.1 Score: 327 E_value: 4e-29
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG2397 Score: 216 E_value: 2e-18
PFAM Definition: No Hit Found
Swissprot: Q9USH8|YJQ2_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0004573 = Molecular function: mannosyl-oligosaccharide glucosidase activity

Sequence:
>Contig4016
AGAGGTCAGACTCGGGTTTAAATACGTTTTTTTTGATACTCGGCAAAGGG
GTGGGGTAACTGGAAGCGCTTACTATCGTATCGTAGAAGGGGAAAAAGAA
AGAAAGAAAGAAAAACACCCAAAATAGTCTACAATTCACTCTTAACATTC
TCTTCAGTATTCTCCCCACGTCCATCTTCCCCTCCACAAACCGCCGCTGT
CCCAACCTCAAACCGATAAACACACTTCTCCTCCTCCCTAACACTCCTAA
GTTCGTCAACAGCACTGCAATATAGATCCACCTTGACACTCCTCCTTGGT
CCATTCCAGCATTGCTGCCCATTTTCGTGAATAAGGCTAGTCCCGCTAAG
CCCCTCATCGTGCGCCTCCTCCCACCCGCTCTCGAAGATGCCGCGGACAG
AGGCGTCGTTAATGGATTTGTCCACTTCGATTCGGGAGTATTCTCCCAGG
GAGACGGAAGAGGAGTCCTTAAGGCTCTTTTGGTATGCGGTTCCGAGGAA
GCAGTATTCGTAGGTGTATTCCCCGAATTGGGAGGATATACATTCGCCCT
TCAGAGGACGGAAGACGTCGTCTTGGCCGTAGGGGTAGGTGAGGTCTGAG
AGAAGAGTTTCTAGGTGGGATTTTGTGTCTGATTCTTCCGTTCTGCCGGT
TTCGAGGGCTTGGCGGGCCGACGCCAGGGCTCTAGACTCTGGCCAA

Sequences in the Contig:

SY0AAB17YP15FM1 SY0AAC21YN21RM1