Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4014
Length(NT) : 428
Best Gene Model Blast : Link to GSTUMT00001137001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_11222
Accession: ref|XP_001801465.1| Score: 249 E_value: 5e-29
KEGG Definition: hypothetical protein
Accession: ncr:NCU06676.1 Score: 239 E_value: 4e-25
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4014
CCCAATGCCATATCAATGCTTGAATGTATAAAGACTACAGAGATTCACGG
AATTGAGCCTTCGTTGATTAAAACTCACATGTTCGAATGGAGTCCTTTGG
CGCTGGGTTGGACGAGTCGCTACTCTGGGGGTTCGTTTTTATTGCGGAGA
GGCATGTTTCAAAGGGCACTGTTGGTGTATGGAATGGGACCGCGGTGAAG
CTATTCAGAGTCCAAGAGACTGCCCCGGAAGGTCCGAGTTTACTGGCACC
TCGAGGCGGTGTGGATGCGATCGGAACCAATCTAATTGAGAGGCTGGGGA
GTGTGAGCTTAGGGAGGGGGCAGCGTCAGCGCAATTCTAGCGACAGCGGG
ACTGGTGGGAACAGAGAAAGGCATGCGGTTGTGTAATTAGTAGATGTCTA
TACTGGATCATAAACCTTTGCTTTTCGG

Sequences in the Contig:

SY0AAA39YP24FM1 SY0AAC21YM14RM1