Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4013
Length(NT) : 1099
Best Gene Model Blast : Link to GSTUMT00011190001 E-value : 0.0
Numbers of ESTs : 40

Blast Results:

Nr Definition: RLA0_NEUCR 60S acidic ribosomal protein P0
Accession: ref|XP_387003.1| Score: 1041 E_value: 1e-111
KEGG Definition: RLA0_NEUCR 60S acidic ribosomal protein P0
Accession: fgr:FG06827.1 Score: 1041 E_value: 1e-111
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0815 Score: 912 E_value: 6e-99
PFAM Definition: Ribosomal_L10, Ribosomal protein L10..
Pfam Number: pfam00466 Score: 291 E_value: 5e-27
Swissprot: Q9C3Z6|RLA0_PODAN

Sequence:
>Contig4013
TTGGATTCACAACAGCTCCCTTTTGGCCACACCTCGCATTCCTGCCCTCA
TCCGTCTTGAACCTTAAAAAACCTCTCTTCATTCTATAAGAAGATATGGG
GGCCAAGACCAACAAAGCAGAATATTTCGAAAAGCTCAAGGGACTCCTCG
AGACCTACACGAGTATTTTCATCGTTACCGTCGACAATGTCTCTTCACAG
CAAATGCACGAGATCCGTGCCTCTCTGAGGGGTCAAGGTGTTGTTCTCAT
GGGAAAGAATACCATGGTTCGCCGCGCCATCCGTGTCTTGCTCTCTGATT
TCCCTGAGTACGAGCGTCTTCTTCCACACGTTAAGGGCAATGTTGGATTT
GTCTTCACCAATGCCGATCTCAACGATGTCCGCGACAAAATTATTTCCAA
CAAAGTCGCCGCCCCCGCTCGTGCCGGCGCCGTCGCTCCTCTCGATGTCT
TTGTCCCGGCGGGCAACACCGGTATGGAACCCGGAAAGACCTCTTTCTTC
CAGGCTCTCGGTGTTCCCACCAAGATTGCTCGTGGTACCATTGAAATTAC
TACCGACCTCAAGCTCGTTGAGGCTGGAAACAAGGTCGGAGCTTCTGAAG
CGACCCTTCTCAATATGTTGAACATCTCTCCCTTCACATACGGTATGGGT
ATCTCCCAGGTCTACGACAAAGGCCAAGTCTTTGCACCGTCGGTTTTGGA
CATCGACGACGAACAGCTTTTGGCCAGCTTTTTGAATGCCGTCAAGACTC
TAGCAACCATCTCTTTGGCTGTAAACTACCCTACCCTGCCATCGGTTATT
CACAGTTTGGTCAACTCTTACAAGAAGGCCATTGCTGTCGCTTTGGAGAC
CGAATACTCCTGGGAGGCGATTGATGAGCTCAAGGACAGGATTGCCAACC
CTGAGGCTTACGCTTCTGCTGGCCCTGCTCCTGGTGCCACTGCCGCTGAG
GACAGCAAGCCAGAGGCTAAGGAGGAGGAGAAGGAAGACGAGGAGTCGGA
GGATGAGGGTGGGTTCGGTGATTTGTTCGGTTAAAATAATTTTTAGACGA
AATGGTATCACGAACTTGAGTAAAATATAATTATTCAATCCTTTCTTCC

Sequences in the Contig:

SY0AAA20YM15FM1 SY0AAA22YH17FM1 SY0AAA22YH17RM1
SY0AAA36YC01FM1 SY0AAA38YK18FM1 SY0AAA54YN05FM1
SY0AAA62YI11FM1 SY0AAB10YF12FM1 SY0AAB20YM07FM1
SY0AAB21YP18FM1 SY0AAB30YO13FM1 SY0AAB31YD14FM1
SY0AAB33YJ02FM1 SY0AAB33YO06FM1 SY0AAB41YL02FM1
SY0AAB44YP05FM1 SY0AAC10YC10FM1 SY0AAC21YL23FM1
SY0AAC21YL23RM1 SY0AAC23YO22FM1 SY0AAC3YF20FM1
SY0AAC42YM23FM1 SY0AAC47YM11FM1 SY0AAC54YH18FM1
SY0AAC8YO15FM1 SY0AAD11YA10FM1 SY0AAD17YL14FM1
SY0AAD18YP02FM1 SY0AAD20YN02FM1 SY0AAD20YN12FM1
SY0AAD22YL08FM1 SY0AAD22YN16FM1 SY0AAD29YF10FM1
SY0AAD31YI10FM1 SY0AAD32YH09FM1 SY0AAD34YA03FM1
SY0AAD38YI04FM1 SY0AAD46YA16FM1 SY0AAD57YC08FM1
SY0AAD58YK04FM1