Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4012
Length(NT) : 712
Best Gene Model Blast : Link to GSTUMT00005180001 E-value : 1e-167
Numbers of ESTs : 3

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001550839.1| Score: 681 E_value: 7e-70
KEGG Definition: conserved hypothetical protein
Accession: fgr:FG02504.1 Score: 668 E_value: 1e-68
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG1494 Score: 558 E_value: 4e-58
PFAM Definition: Ldh_1_C, lactate/malate dehydrogenase, alpha/beta C-terminal domain. L-lactate dehydrogenases are metabolic enzymes which catalyse the conversion of L-lactate to pyruvate, the last step in anaerobic glycolysis. L-2-hydroxyisocaproate dehydrogenases are also members of the family. Malate dehydrogenases catalyse the interconversion of malate to oxaloacetate. The enzyme participates in the citric acid cycle. L-lactate dehydrogenase is also found as a lens crystallin in bird and crocodile eyes..
Pfam Number: pfam02866 Score: 335 E_value: 3e-32
Swissprot: P17505|MDHM_YEAST
Gene Ontology:
GO:0005759 = Cellular component: mitochondrial matrix
GO:0030060 = Molecular function: L-malate dehydrogenase activity
GO:0005515 = Molecular function: protein binding
GO:0006108 = Biological process: malate metabolic process
GO:0006099 = Biological process: tricarboxylic acid cycle

Sequence:
>Contig4012
GTATAGTTCTCAAAAGCTCATTGGACAAAGGACACAAAATATGCCACCAA
TGATAGGTGACCATGCCTTCCCTCTCTGTAAAATAAAACCCCCAACCAAA
CAGGTATCATCCACTTCAGGCCGTGTTCCAAGCGAGATTTTCATTTTGCA
GGCTCAGCCGAGGCAAACTCGACACCCTTGTCAATGTTCGTCCTCAATCC
CTTGATGGCCACCTCAAGAAGTTTCTTTTCGTCATCGTTGATTGTCTCGA
GAGGGTTGGTAGCCCTTGCAACTCCGTTTGGCCCAAGCTCGACAGGAACC
GCAAAGAAATCTACGCCAACAGCCTTCGCAATCTCATCACCTCCTGGAAC
GTCAGGGAGGTAAATATAAGAGGGCTCGACGATTCCCTTCTCTCCGCCAA
CTGCCTTCATAACAGCTTCAGCGAATCTGAATCCGGCAAATGCCATAGAC
AGAGTGGCCGAGCCAGCACCATCCTTGGCTTTAACAACCTCATCACCACC
AAACTGGATACGATTTACCAATCCGGCAAGTCTATCTTCGGGGATAGAAA
CTGGAGGCTTGGCCAAGCTCAACAATGGAACAATGGTATCACCGCTATGC
CCACCGACTACTGGTACGACAATATTACGCGAGTCCTTCTCACCAGTAAT
CTCGGCGACAAAGGTTGAAGCACGGACGACATCCAATGTGGTAACACCAA
AAAGGCGGCCAA

Sequences in the Contig:

SY0AAC15YI15FM1 SY0AAC21YL22RM1 SY0AAC25YD01RM1