Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4011
Length(NT) : 2420
Best Gene Model Blast : Link to GSTUMT00004391001 E-value : 0.0
Numbers of ESTs : 252

Blast Results:

Nr Definition: flavin-binding monooxygenase, putative
Accession: gb|EDP55403.1| Score: 1495 E_value: 1e-163
KEGG Definition: flavin-binding monooxygenase, putative
Accession: afm:AFUA_6G13790 Score: 1492 E_value: 1e-163
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG1399 Score: 218 E_value: 5e-18
PFAM Definition: FMO-like, Flavin-binding monooxygenase-like. This family includes FMO proteins and cyclohexanone monooxygenase..
Pfam Number: pfam00743 Score: 198 E_value: 8e-16
Swissprot: Q00730|STCW_EMENI

Sequence:
>Contig4011
TTGGGCGAAAGGTCGGAAGCCTAACCTACGGATTCCGGTAAGCACAGACA
AGCACGTTCAGAGCTGAAAACGAAGAAACGCCTGGGTGATCTCGTACTAT
CTGTGTCTTGAGACCCAGGTTAACAAAGGAATAACCAAGGCAGTTCGAGA
TTCCATGCATGTTCGAGATTCCCCCAATCAATACCATTGTCAAGCTATGA
TCTCCGGCTCGAACTTCCCTGGAGTCCGAAAAGCCACTATGATATCCAGA
TTTCTGGGATCCTGGCACATTTGGCCCTGTCAATTTGTTCTCGTCAAGCG
AAGATCCACATTGGTAAATACGTTATGCTAGTATCACAAACACAGAGAAT
CTCCCGATTAGTACGGCACGCCGCCCGAACACCCACAGAATTGTCAATTC
CCCGTCTCTCCAGAGAAGCCACTAGGGACGCCTCTAACTAGTATAAGAGA
CCCCTATTCCTCTCTTCCAGCCCCCCCCTCATCAGCAACAGTTTGGGTGA
TACCCTACAGTCTTCTTCATATCGAAGTCTTCATTTGCGAGCCTCACTAT
CTCTCCATAATGGCCCCACCTCATGTCGATGATCAGTACTCTGCGGGCTC
CACCTACCCACCAAACTGGATTCCAGTTGTGGAGAAACCCCTACGCACCC
CGAAACGAGTGAGAATTATTACTGTAGGTGCTGGGCATTCCGGATTAATG
CTTACGTACAAGATTAGAAACCAGTTCAAGTACGGGGACTTTATGGACCA
CATTATCTATGAGAAAAACCATGATATTGGCGGAACGTGGCTTGAGAACA
GATACCCAGGGGTTGCCTGTGATGTTCCTGCTCATATATACACCTTCTCA
TGGGAGCCAAATCCGGACTGGAGCGAGTTTTACGTTGGCGGAGAAGAAAT
TTTCCAATACATGAAGCGTACAACGGCGAAATACGACCTTGCAAGAGATG
TTGTTTTCAATTCCAAGGTTGTGGAAGCCATCTGGGACCAGGGGCGAGGT
AAATGGGAGCTCAAGATTGAGCAAGAGGGACGATTTATCTGGGACGAATG
CGATATCTTTATAAACGCCTCAGGGATCCTGAATAAATGGAAGTTACCAT
CCATTGAAGGAATAAACGCTTTCAAGGGACACTTGGTGCATAGTGCGAAA
TGGGAGGATACTTACGACTTTGCTGGAAAGAGAGTTGGAATTATTGGAAA
CGGATCTTCCGCACTTCAGATCGTCCCCAAGCTACAGGAAGTCGCTGGAC
ACCTAGTAAACTTCATGCGTACCCCAACCTGGATTAGTGCGACATACTCT
TCTGAGCTTCTTCCTGATGGAAAGAACTTCTACTATACAGAAGAGCAGAA
GTCTGAATTCCGGAACAATCCTAAGTTGTTAAACGAGTATCGCAAAAAAA
TTGAGAGCGGCTTCAACAAATTCTTCTATGCCCTTCTCAACGACTCCCCT
GCCCAAGCTGCTATAACGGAGCAGTACACACAAATTATGTCCGAGCGCCT
CGGTAACGACCCAGAGCTTATCAAAAAATTTATACCAAGCTGGAGAGTTG
GTTGCCGTCGTCTATCTCCCGGGGAAGGGTATCTGGAAGCCCTGCAGGCC
CCCAATGCGAAATACACATGGGATCCTATCGAGCGCATTACCGAGAAGGG
CGTAGTGACATCCGCTGGCGAAATCGAACTGGATGCAATTGTATGCGCCA
CGGGCTTCGACGTCTCTTTCATGCCCCAGTGGAAAATGCGAGGGCTCAAC
GGCTCTACATTGGACAAATGGCGGGATGACCCTGAAGGATATTTGGGAAT
ATTCGCCCCCAGCATGCCCAATTACTTCATCGTTAACGGGCCCAATTGCC
CCGTCGGACACGGCTCACTGCTCTCCGTCATGGAGTGGACAACGGAGTAC
ATCATCCGCTGGGCCAAGAAAATAGCTTCCGAGAACATCAAAGCCGTAAT
GGTAAAGCCCAACGTAGTCCGAGAATGGAATGTCTACGCCCAAGAATACC
TCAAGCGCACCGTCTGGACCAGCGGTTGCCGCTCCTGGTACAAGAATGGC
AAAATCGAGGGGAAAGTCACGGCAACATACCCTGGTAGCGTCATCCACTA
CAAAGAAGTCTTGGAAACCATCCGCGGTGAAGACTTTAACATCGAGTACT
CCGAGCCCAGGAACAGGTTTGGCTTCATGGGAAATGGTTTCACGGCTCTT
GAGATGGATGAGGATGCGGATTTGGCATTTTATATGTATAAGTGAGGCTC
TGTAATCGAGTTCTTGCAGACTTAGTTTCGAGATAGCCATTCAGCTCCCG
TGTTTGTTAGTTGGGTATATTTGTTAGATTGGCCTCAGGGATTTAATTTG
AGTCTACAACGATACACCCGCCTCCACCATTCTCCCAGAAGGCGGTCGAG
TGAGGATTTGTGATCTTGGG

Sequences in the Contig:

SY0AAC10YO03FM1 SY0AAC11YE11FM1 SY0AAC11YI06FM1
SY0AAC11YL15FM1 SY0AAC11YN02FM1 SY0AAC12YB23FM1
SY0AAC12YF05FM1 SY0AAC12YG11FM1 SY0AAC13YD20FM1
SY0AAC13YP06FM1 SY0AAC14YL05FM1 SY0AAC14YL13FM1
SY0AAC15YC09FM1 SY0AAC15YH02FM1 SY0AAC15YJ04FM1
SY0AAC15YN01FM1 SY0AAC15YP08FM1 SY0AAC17YJ15RM1
SY0AAC17YO19FM1 SY0AAC17YP04FM1 SY0AAC17YP10FM1
SY0AAC18YP22FM1 SY0AAC19YJ17FM1 SY0AAC1YH22FM1
SY0AAC1YK17FM1 SY0AAC1YK23FM1 SY0AAC20YC24RM1
SY0AAC20YG13FM1 SY0AAC20YG13RM1 SY0AAC21YL18FM1
SY0AAC22YJ10FM1 SY0AAC22YL11FM1 SY0AAC22YO15FM1
SY0AAC22YP11FM1 SY0AAC23YC11FM1 SY0AAC25YL07FM1
SY0AAC26YJ13FM1 SY0AAC27YF13FM1 SY0AAC27YF13RM1
SY0AAC28YH15FM1 SY0AAC28YH15RM1 SY0AAC29YH13FM1
SY0AAC2YB08FM1 SY0AAC2YB21FM1 SY0AAC30YF23FM1
SY0AAC30YM14FM1 SY0AAC32YE21FM1 SY0AAC32YO08RM1
SY0AAC33YE18FM1 SY0AAC35YB02FM1 SY0AAC35YF07FM1
SY0AAC35YH22FM1 SY0AAC35YM18FM1 SY0AAC37YD04FM1
SY0AAC38YB10FM1 SY0AAC38YI15FM1 SY0AAC38YI24FM1
SY0AAC39YM21FM1 SY0AAC3YN04FM1 SY0AAC40YE14FM1
SY0AAC41YJ11FM1 SY0AAC42YD03FM1 SY0AAC42YF03FM1
SY0AAC42YK01FM1 SY0AAC43YC03FM1 SY0AAC43YC11FM1
SY0AAC43YD22FM1 SY0AAC43YE13FM1 SY0AAC44YA15FM1
SY0AAC44YF12FM1 SY0AAC44YN08FM1 SY0AAC44YP06FM1
SY0AAC44YP17FM1 SY0AAC45YC18FM1 SY0AAC45YO13FM1
SY0AAC46YB20FM1 SY0AAC46YD06FM1 SY0AAC46YG08FM1
SY0AAC46YH06FM1 SY0AAC46YI08FM1 SY0AAC46YL05FM1
SY0AAC47YB04FM1 SY0AAC47YP09FM1 SY0AAC48YB10FM1
SY0AAC49YB11FM1 SY0AAC49YE23FM1 SY0AAC49YI02FM1
SY0AAC49YN02FM1 SY0AAC49YN08FM1 SY0AAC4YG20FM1
SY0AAC4YM18FM1 SY0AAC51YD13FM1 SY0AAC51YF03FM1
SY0AAC51YJ09FM1 SY0AAC51YL05FM1 SY0AAC51YM15FM1
SY0AAC51YP04FM1 SY0AAC52YE23FM1 SY0AAC52YG21FM1
SY0AAC52YL13FM1 SY0AAC53YL02FM1 SY0AAC53YN12FM1
SY0AAC54YE03FM1 SY0AAC54YG08FM1 SY0AAC54YI03FM1
SY0AAC55YE02FM3 SY0AAC55YG02FM3 SY0AAC56YA24FM1
SY0AAC56YF24FM1 SY0AAC57YB17FM1 SY0AAC57YM10FM1
SY0AAC58YO11FM1 SY0AAC59YC24FM1 SY0AAC59YH11FM1
SY0AAC59YH21FM1 SY0AAC59YL13FM1 SY0AAC5YO23FM1
SY0AAC60YJ08FM1 SY0AAC60YL22FM1 SY0AAC61YG18FM1
SY0AAC61YI10FM1 SY0AAC61YM04FM1 SY0AAC62YA20FM1
SY0AAC62YF16FM1 SY0AAC6YE12FM1 SY0AAC7YG10FM1
SY0AAC7YI07FM1 SY0AAC8YF11FM1 SY0AAC9YC16FM1
SY0AAD10YK11FM1 SY0AAD10YP20FM1 SY0AAD11YB18FM1
SY0AAD11YF05FM1 SY0AAD11YN24FM1 SY0AAD12YB21FM1
SY0AAD12YJ12FM1 SY0AAD13YG07FM1 SY0AAD14YF01FM1
SY0AAD14YF17FM1 SY0AAD15YD14FM1 SY0AAD15YF10FM1
SY0AAD15YG01FM1 SY0AAD15YM01FM1 SY0AAD18YC13FM1
SY0AAD18YD06FM1 SY0AAD19YE07FM1 SY0AAD19YI15FM1
SY0AAD1YB19FM1 SY0AAD1YI07FM1 SY0AAD1YK09FM1
SY0AAD20YK01FM1 SY0AAD20YN06FM1 SY0AAD22YL09FM1
SY0AAD23YE20FM1 SY0AAD23YE22FM1 SY0AAD23YH05FM1
SY0AAD24YA14FM1 SY0AAD25YB16FM1 SY0AAD26YE22FM1
SY0AAD26YK06FM1 SY0AAD27YK01FM1 SY0AAD27YO24FM1
SY0AAD28YO04FM1 SY0AAD29YD20FM1 SY0AAD29YI03FM1
SY0AAD30YD21FM1 SY0AAD30YE06FM1 SY0AAD31YF24FM1
SY0AAD32YD12FM1 SY0AAD32YG15FM1 SY0AAD34YE09FM1
SY0AAD34YM05FM1 SY0AAD34YM21FM1 SY0AAD35YJ07FM1
SY0AAD35YM12FM1 SY0AAD36YB05FM1 SY0AAD36YM19FM1
SY0AAD38YE09FM1 SY0AAD39YJ14FM1 SY0AAD39YK05FM1
SY0AAD3YI03FM1 SY0AAD40YE20FM1 SY0AAD40YO08FM1
SY0AAD41YB09FM1 SY0AAD41YN13FM1 SY0AAD43YB02FM1
SY0AAD43YK12FM1 SY0AAD43YN02FM1 SY0AAD44YB07FM1
SY0AAD44YB15FM1 SY0AAD44YC14FM1 SY0AAD44YJ18FM1
SY0AAD44YM24FM1 SY0AAD45YA12FM1 SY0AAD45YL02FM1
SY0AAD45YN22FM1 SY0AAD46YB03FM1 SY0AAD46YI03FM1
SY0AAD49YA15FM1 SY0AAD49YJ21FM1 SY0AAD49YO03FM1
SY0AAD49YP15FM1 SY0AAD4YC14FM1 SY0AAD4YM18FM1
SY0AAD50YB02FM1 SY0AAD50YB07FM1 SY0AAD50YM10FM1
SY0AAD50YP09FM1 SY0AAD51YB21FM1 SY0AAD51YE07FM1
SY0AAD51YI22FM1 SY0AAD51YP14FM1 SY0AAD52YA17FM1
SY0AAD52YJ14FM1 SY0AAD55YP12FM1 SY0AAD56YA13FM1
SY0AAD56YC02FM1 SY0AAD56YG01FM1 SY0AAD57YF12FM1
SY0AAD57YH03FM1 SY0AAD58YC23FM1 SY0AAD58YF01FM1
SY0AAD59YB15FM1 SY0AAD5YA24FM1 SY0AAD60YA02FM1
SY0AAD60YA17FM1 SY0AAD60YB12FM1 SY0AAD60YK24FM1
SY0AAD60YL07FM1 SY0AAD60YM11FM1 SY0AAD60YN13FM1
SY0AAD60YN19FM1 SY0AAD60YO06FM1 SY0AAD61YD06FM1
SY0AAD62YB24FM1 SY0AAD62YD06FM1 SY0AAD62YE01FM1
SY0AAD62YI02FM1 SY0AAD62YJ05FM1 SY0AAD63YB22FM1
SY0AAD63YE06FM1 SY0AAD63YK22FM1 SY0AAD63YO07FM1
SY0AAD6YF01FM1 SY0AAD7YA16FM1 SY0AAD8YC07FM1
SY0AAD8YC21FM1 SY0AAD8YH09FM1 SY0AAD8YN07FM1
SY0AAD9YH23FM1 SY0AAD9YI20FM1 SY0AAD9YP23FM1