Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4010
Length(NT) : 635
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 3

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001626260.1| Score: 876 E_value: 1e-92
KEGG Definition: NEMVEDRAFT_v1g215693; predicted protein
Accession: nve:NEMVE_v1g215693 Score: 876 E_value: 7e-93
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0651 Score: 763 E_value: 5e-82
PFAM Definition: AAA, ATPase family associated with various cellular activities (AAA). AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes..
Pfam Number: pfam00004 Score: 134 E_value: 4e-09
Swissprot: P62335|PRS10_SPETR

Sequence:
>Contig4010
TATTTATTGAGCTTTATCATGACTGCCGAAGAGAGGCGGGAGCGGGCTCT
TGTTGAGTACCGGAAAAAACTGATGGAGCACAAAGAGATCGATGCCAAGT
TGAAGAAAATGAGAGAGGAGCTGAAGGATTTCCAGAAGGACTACGACAAA
TCTGAGAATGACTTAAAAGCCCTGCAGAGTGTTGGTCAGATAGTGGGTGA
GATGCTCAAGCAGCTGTCCGAGGAGAAGTTTATTGTGAAGGCTTCGAACG
GTCCCCGGTATGTTGTTGGCTGCCGACGCCAGATCGACCGTGCTAAACTT
ATCCCTAACACCCGTGTTGCTCTGGACATGACCACCCTCACGATCATGAG
GTGCCTGCCCCGTGAGGTTGATCCTCTCGTCTACAAGATGAGCCACGAGG
ATCCTGGTGACGTGAAATACTCCAGTGTGGGAGGTCTTGGTGAGCAGATC
CGGCAACTTCGGGAGGTCATCGAACTGCCACTCATTAACCCTGAGCTGTT
CCTTCGAGTTGGTATAACACCTCCCAAAGGATGCTTGTTGTACGGCCCAC
CAGGAACTGGTAAAACGCTGTTGGCAAGGGCCGTCGCGTCTCAGCTAGAG
ACCAACTTCCTTAAGATCGTCTCAAGTGCTATCGT

Sequences in the Contig:

SY0AAC20YL12RM1 SY0AAC21YL12RM1 SY0AAC32YL12RM1