Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig401
Length(NT) : 555
Best Gene Model Blast : Link to GSTUMT00007891001 E-value : 4e-50
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig401
CGTTACGGTAGTTTGTTTGGTCATTAATTCTTTAGAAGTTCCCCTCCCAT
TGCTCTTGTGATATCCCTCCACCTACACGCACTTTTTCTCTCCGGCTATC
ACTGGGTACTGTACTTTATGATATCGCACCGCATCTTCGGGGTCCCGCGC
AACCTCCGCAATTAACTTGAAGCATGCCCCACTCTTCAAACTTCCCAGCG
CTGCACCATGGCATTATAAAAGAAACATGATATACTCGCTAATCTCAAGC
TACGCAATTTTCTTTTCCCCATATACCACATTACTCTGACCTCATTTAGC
AAAAGGATGCAAAAAGAAAGGGAAAGAAAGATCAAATTGAAAAGAAAGAA
AAAACTAGGGAATAAGACAACCTAGTCATAAGAGCTAGGGATAAAAACAG
ACAAAACAATGAAATAGTCATATGAGAATGGCACACCGGGGTTTGAATAG
GTGAGTACTGTGGTAATATTGTGCTTGAGATTCTGATGAATATGCCACCA
GATCCTGCTTCGCCAACTAGTTCTCTAGGCAGGGATTTTGCCCTCATTCT
TAGCT

Sequences in the Contig:

SY0AAA22YO17FM1 SY0AAC19YI12RM1 SY0AAC19YP14RM1
SY0AAC21YA02RM1