Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4009
Length(NT) : 1186
Best Gene Model Blast : Link to GSTUMT00004855001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein CHGG_08652
Accession: ref|XP_001226579.1| Score: 556 E_value: 5e-55
KEGG Definition: hypothetical protein ( hypothetical protein B23L21.370 [imported] - Neurospora crassa OR74A )
Accession: ncr:NCU03926.1 Score: 524 E_value: 1e-51
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG3933 Score: 201 E_value: 2e-16
PFAM Definition: DUF1421, Protein of unknown function (DUF1421). This family represents a conserved region approximately 350 residues long within a number of plant proteins of unknown function..
Pfam Number: pfam07223 Score: 112 E_value: 4e-06
Swissprot: Q03976|RT24_YEAST
Gene Ontology:
GO:0005763 = Cellular component: mitochondrial small ribosomal subunit
GO:0003735 = Molecular function: structural constituent of ribosome
GO:0009060 = Biological process: aerobic respiration
GO:0006412 = Biological process: translation

Sequence:
>Contig4009
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACCAAA
GTTGTCCCCATCACTCCCCTCACCACACCACTACCCCACCGCAAACGACC
GCAATGGCATCATCCCTCTCCCGCACAATTGTCCACCTCCCCCGCCTCGC
CCGGCGGACAATGCCCACCACCCGGCCATCCGCGAGGCACCTCACCTCGT
CCCCTCACCCCTCGTACGACCAGCCAATCCTCATCTCCCAAACCCCTCCC
CCCAAGCCGGCGGACAGGGACCCGAACGAGGTCGAGGAGAAGGACTGGGA
GGGCGACGACTTTACCTCCAGTGGGCACTCGGAGCTCCTCCGCCACCGCG
AAGCGCGGTCATACGCGCGCCTGGCGATGTACGAGATGCCACTCCTGTCG
AGGCTCTCGAAGCCCTTCCGTCCGCCGTCGCGCGCTGAGGTGCTGCGCTT
CCGCTACACCACCTACTTTGGCGAGGCCCACCCGGCTGAGAGCAAGGTAG
TTGTGGAGTTTGCGCCGAGGGACCTGGTTAGCCTGACGGCGGCGCAGAGG
GGGAAGCTGGTCAAGATGGTCGGGGCCAGGTTCGATCCGGAGAGGGGGGT
CGTCAAGATGTCTTGCGAGATGTTTGAGTTGCAGGCGCAGAATAAGCGGT
ATTTGAGCGATTTGGTGGATAGGTTGATCTTGGAGGCTAAGGATGAGAGT
GACGACTTTGGTGATATTCCGTTCGATTTCAGGCATTATACGGCCAAATT
GAAGAGGCCCAAGGCGCGGTTTCCTAAAGCTTGGAGAATGAATGAGGAAA
GGATGGCTAGTATTAGGGAGGAGAGGGCGGCGTTTGCAAAGTTATTTGAG
AGGGGAGGTGTTACTGTTTAACCCAAAATTTCCCCTCCCACTCACTCACT
CGCTCGCTCGATAGGTTTTGGCTTGGGGGTATGGGCTTGTACCTGTAATA
TAGGCGCTTTCATGGTATAAATGGGTCTCTTTTCTTTCATTCTTTCGTTC
TTTGATTCTTACATGCGACATTATGATTTTCTGGAAATTTCGGGGTTTGG
CACATATCTTTTAGATGGCACACAAGTGTTATGGAATTAACGGGAATACG
GGAAGAGTAGCGCATAGGTTGCAAAGATAAGATGGAATATGAGGTAGAGT
GACGGAAACGCTAGGCGATCACTCTTATAATATTGT

Sequences in the Contig:

SY0AAA2YK01FM1 SY0AAA42YK10FM1 SY0AAA55YH10FM1
SY0AAC21YL07FM1 SY0AAC21YL07RM1 SY0AAC34YC02FM1
SY0AAD35YD15FM1